ID: 1017740159

View in Genome Browser
Species Human (GRCh38)
Location 6:157399439-157399461
Sequence TGTATATATGCCCTGTCTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017740157_1017740159 -1 Left 1017740157 6:157399417-157399439 CCTCATCTGTCATCTGTAGTTGT 0: 1
1: 0
2: 3
3: 19
4: 196
Right 1017740159 6:157399439-157399461 TGTATATATGCCCTGTCTTCGGG 0: 1
1: 0
2: 0
3: 11
4: 126
1017740156_1017740159 26 Left 1017740156 6:157399390-157399412 CCGTGGGATAAGAAATAAAAGTG 0: 1
1: 0
2: 1
3: 30
4: 355
Right 1017740159 6:157399439-157399461 TGTATATATGCCCTGTCTTCGGG 0: 1
1: 0
2: 0
3: 11
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017740159 Original CRISPR TGTATATATGCCCTGTCTTC GGG Intronic
900354451 1:2253544-2253566 TGCACATATGCCCTGTCTCAGGG + Intronic
904895052 1:33810939-33810961 TGTACAGATGCAGTGTCTTCTGG - Intronic
906089361 1:43165362-43165384 TGTACATATGCCCTCACTTGAGG + Intronic
911971249 1:104440615-104440637 TGTATATATTTCCTTTATTCAGG + Intergenic
913037720 1:114988487-114988509 TATATAAATTCACTGTCTTCTGG - Intronic
917934616 1:179852785-179852807 TGTATATATGCCTTATTTCCTGG - Exonic
1063027169 10:2191934-2191956 TGTGTTTTTGCTCTGTCTTCTGG + Intergenic
1063856700 10:10263171-10263193 GATATATATCCACTGTCTTCTGG + Intergenic
1065240767 10:23701724-23701746 TGTTTAAATGCCCTGTTGTCTGG + Intronic
1066993918 10:42544338-42544360 TGCATATTTGCCCTGTTTTAGGG - Intergenic
1068262711 10:54603595-54603617 AGTATATAAGCCCTGGGTTCTGG - Intronic
1069227017 10:65957706-65957728 TGAATATTGGCCCTCTCTTCTGG + Intronic
1070221667 10:74454490-74454512 TGGATTTATACCCTGCCTTCAGG - Intronic
1070617193 10:77978172-77978194 TCTATAGGTGCCCTGCCTTCTGG - Intronic
1071251639 10:83825201-83825223 TCTATATATGCCCAGTTTTTAGG - Intergenic
1071445479 10:85742533-85742555 TGTTTAATTGCCCTGTTTTCAGG + Intronic
1073717939 10:106129103-106129125 AGTATAGATGCCCTTTCCTCTGG - Intergenic
1074766946 10:116706562-116706584 TGCAAAGCTGCCCTGTCTTCCGG + Intronic
1074877320 10:117623497-117623519 TATATATATGCACTGTCTCCAGG + Intergenic
1075358528 10:121807040-121807062 TAGACATAGGCCCTGTCTTCAGG - Intronic
1079680757 11:23294395-23294417 TGTATATATGCCATTTTCTCTGG - Intergenic
1080066504 11:28021779-28021801 TCTATTTATGCCCATTCTTCTGG + Intronic
1080319826 11:30994550-30994572 TGTATATATGCCCTTTGTAAGGG + Intronic
1082134725 11:48533990-48534012 TGTAGAAATCACCTGTCTTCTGG + Intergenic
1082853951 11:57789933-57789955 TGTAAAAAAGCACTGTCTTCAGG - Intronic
1087834631 11:102860530-102860552 TGTATATATGTCTGTTCTTCAGG - Intergenic
1088683030 11:112260651-112260673 TGTTTATATGCCAGGGCTTCTGG + Exonic
1089395695 11:118135423-118135445 TTTTTTGATGCCCTGTCTTCTGG - Exonic
1090352366 11:126115543-126115565 GTTATATATTCCCTATCTTCAGG - Intergenic
1091681531 12:2531017-2531039 TGTATACATGCCCAGTGTCCAGG + Intronic
1092681869 12:10992269-10992291 TGGATATATGTCCTTTCCTCTGG - Intronic
1093325265 12:17766974-17766996 TGTAGCTCTGCCCTTTCTTCTGG + Intergenic
1100103681 12:91141902-91141924 TGTGCATATGCCCTTTCTTTTGG + Exonic
1100806849 12:98294417-98294439 TGTGTTTAAGCCCTGTTTTCAGG - Intergenic
1102085585 12:110135940-110135962 TGTATCTATACACTGTCTTTTGG + Intronic
1102133878 12:110556323-110556345 TATATATATGCACTGTATTAAGG - Intronic
1102236160 12:111296029-111296051 TGTGGATCTTCCCTGTCTTCCGG + Intronic
1104483021 12:129125005-129125027 GGTAAATATGCCATCTCTTCAGG - Intronic
1105742554 13:23342946-23342968 TGTAAATATGCTCTGTATTTGGG - Intronic
1105904059 13:24786685-24786707 TGTAAATATACATTGTCTTCGGG + Intronic
1105971288 13:25431046-25431068 TGTGCATATGGTCTGTCTTCTGG + Intronic
1111342290 13:86902533-86902555 TGTATGTTGGTCCTGTCTTCTGG - Intergenic
1114319872 14:21538403-21538425 TCTGGATATGCCCTGTCTTCTGG + Intergenic
1114932151 14:27486494-27486516 TGGTTTTATGCCCTTTCTTCCGG + Intergenic
1126488990 15:49215453-49215475 TTTTTATATAGCCTGTCTTCAGG + Intronic
1127885496 15:63196025-63196047 TGTATGTATTCCCTCTCTTAGGG + Intronic
1131033337 15:89204827-89204849 TGTATACATGTCCTGCCTACTGG + Intergenic
1137658435 16:50181724-50181746 TGTACATGTGCTGTGTCTTCTGG + Intronic
1140234978 16:73150743-73150765 TGTATACAGGCTCTGTCATCCGG - Intergenic
1142421577 16:89973710-89973732 AGTATTTCTGTCCTGTCTTCAGG + Intergenic
1147602070 17:41752950-41752972 TTTATATGTGCTCTGTGTTCAGG - Intergenic
1154010055 18:10566647-10566669 TGTGTTTATGCCCTGTCTGAAGG - Intergenic
1155587468 18:27383796-27383818 TTTATACATGCCCTTTCTTTAGG + Intergenic
1159020566 18:63139654-63139676 TGTATATAGGCCCTTTCTTTAGG - Intronic
1159500476 18:69262665-69262687 TATATATATGACTTATCTTCAGG - Intergenic
1163892770 19:20031524-20031546 TGCATATAAGCACTGGCTTCTGG - Intronic
1168060830 19:53891205-53891227 GGGCTCTATGCCCTGTCTTCTGG + Intronic
925286354 2:2718118-2718140 TGAAAATATGCCAGGTCTTCAGG + Intergenic
929891150 2:45919468-45919490 TGTGTTTATGCCTTGTCTTGGGG + Intronic
930148891 2:48037697-48037719 TGTATACATATCCTGTTTTCTGG - Intergenic
930440704 2:51401885-51401907 TGTATATATGCCACCTCCTCTGG - Intergenic
931200783 2:60095617-60095639 TGTAGATATGCCATGTCTTGTGG - Intergenic
931615551 2:64153002-64153024 TGAATATATGCCCTGGCAGCTGG - Intergenic
932178660 2:69625669-69625691 TACATATATTTCCTGTCTTCTGG - Intronic
932797937 2:74713892-74713914 TGTGTATGTGCCCTGGTTTCAGG + Intergenic
933079777 2:77971603-77971625 TATATATATGCCTTGCTTTCTGG - Intergenic
938132582 2:128730488-128730510 TGCATATCTGCTCTGGCTTCTGG - Intergenic
938391067 2:130906304-130906326 TGTTTATCTGCCCTGTCTGCTGG - Intronic
939127261 2:138192666-138192688 CTTATATTTGGCCTGTCTTCTGG + Intergenic
942299045 2:174544678-174544700 AGTAGAAATGCCCTCTCTTCAGG + Intergenic
942911561 2:181250633-181250655 TCTATATATCCCTTGTATTCTGG - Intergenic
944722118 2:202434268-202434290 TTTAATTATGCCCTGTCTTCAGG - Intronic
947222224 2:227804549-227804571 TGTGGATATGCCATGTGTTCTGG + Intergenic
1170031128 20:11945215-11945237 TGTACATTTGCCTTGTTTTCAGG - Intergenic
1170290917 20:14767488-14767510 TTTATATATGTATTGTCTTCAGG - Intronic
1177075559 21:16567736-16567758 TGTATATATTCTCTTTCTGCTGG + Intergenic
1178180836 21:30159550-30159572 TGTTTGTTTGCCCTGTTTTCTGG + Intergenic
1183088364 22:35502534-35502556 TATATATATGCCCTTTCTCCAGG + Intergenic
1185162809 22:49239723-49239745 TGTTTTTCTGCACTGTCTTCAGG - Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
949979293 3:9490909-9490931 TGTATCTTTGCCCTGTCAACTGG + Intergenic
956947921 3:74244739-74244761 TGTATGTCTGTCCTGACTTCTGG - Intergenic
956958577 3:74371307-74371329 TGTAGAGGTGCCCTGTCTCCTGG + Exonic
960358475 3:116681068-116681090 TTTTTATATGCCATCTCTTCAGG + Intronic
961049315 3:123733497-123733519 TGTAGAAATGCCCTTTATTCTGG - Intronic
962364386 3:134768112-134768134 TGTATAAAAGCCCTGTGATCTGG - Intronic
964162071 3:153657581-153657603 TGTATTTATCTCCTTTCTTCAGG + Intergenic
971151736 4:24040030-24040052 TGTATATGTATACTGTCTTCAGG - Intergenic
971711118 4:30113912-30113934 TGTAAATATTCCCTGTGATCTGG - Intergenic
971926485 4:33015687-33015709 TGTCTATATCCCTTGTCTCCAGG - Intergenic
972510684 4:39765889-39765911 TATATATATATCCTGACTTCAGG - Intronic
974334001 4:60516186-60516208 TGTATATAGCCCCTGTATTCTGG - Intergenic
978387920 4:108194433-108194455 AGTAAATGTGCTCTGTCTTCAGG - Intergenic
979413618 4:120408208-120408230 TTTTTAAATACCCTGTCTTCAGG - Intergenic
980470921 4:133250521-133250543 ACTATATATGGCCTTTCTTCAGG - Intergenic
981310906 4:143297355-143297377 TCTATATATGCCATCACTTCAGG + Intergenic
981581244 4:146250383-146250405 TGTATTTAGTCGCTGTCTTCAGG + Intergenic
983761725 4:171416569-171416591 TTTATATATGCCCTGACTCGGGG - Intergenic
986440537 5:7777486-7777508 TGGAGATAGGCTCTGTCTTCAGG - Intronic
991592758 5:68271408-68271430 TGTTAAGATGCCTTGTCTTCAGG + Intronic
993267693 5:85747686-85747708 TGTATTTTTGCCCTCTCTTTCGG + Intergenic
993719278 5:91306096-91306118 TGTATCTCTGCCTTGTCTCCAGG - Intergenic
996517219 5:124383899-124383921 TGTATGTATCCACTGTCTTCTGG - Intergenic
1002361036 5:178671054-178671076 TGTATATATGTGCAGTTTTCTGG - Intergenic
1003531532 6:6941201-6941223 TGTATATATGACTTGTCCTTAGG + Intergenic
1004132468 6:12933739-12933761 TGTATGTAGGGGCTGTCTTCAGG - Intronic
1009761570 6:68013368-68013390 GTTAAATATGCCCTGTCTTTAGG + Intergenic
1011172985 6:84527071-84527093 TGTCTATAGGCCCTGTCTATGGG + Intergenic
1013645931 6:112141324-112141346 TGCATATATGCCCTGTGTCATGG + Intronic
1014102149 6:117523168-117523190 TGGATATATTCCCTTTCTTTAGG - Intronic
1015346797 6:132169906-132169928 TGTATATATGCCATTTTTACAGG + Intergenic
1017740159 6:157399439-157399461 TGTATATATGCCCTGTCTTCGGG + Intronic
1021395500 7:20143152-20143174 TGTATCTATGGCCTATCTTGCGG + Intronic
1021574316 7:22093806-22093828 TGTATATGTCCCCTGGCTGCTGG + Intergenic
1024407056 7:48993795-48993817 TGAATATATGCACTGTTTTTTGG - Intergenic
1028206437 7:88022770-88022792 TATTTATATACTCTGTCTTCTGG + Intronic
1028481318 7:91309142-91309164 TGTATATATTTCCTGTTCTCTGG - Intergenic
1031680537 7:124668025-124668047 TCTATATATGCCCTTTAGTCTGG + Intergenic
1032921447 7:136553011-136553033 TTTCTAAATGCCCTGTATTCTGG - Intergenic
1033452597 7:141475031-141475053 TGAAAATGTTCCCTGTCTTCAGG + Exonic
1036495195 8:9263898-9263920 TGGATCTATGTCCTGTCTTAAGG - Intergenic
1040463415 8:47671710-47671732 TGAAAATATTCCATGTCTTCTGG + Intronic
1040592428 8:48805799-48805821 CCCATATATGCCCTGTCTCCTGG + Intergenic
1045300053 8:100903204-100903226 TGTATATAAGGCCAGTCTTGTGG - Intergenic
1048373462 8:133801102-133801124 TGTACAAAGGCCCTGTCTGCTGG + Intergenic
1051602452 9:18888935-18888957 TGCAAATAGGCCCTGGCTTCTGG - Intronic
1052154693 9:25170626-25170648 TGTATAAATGTCCAGTCTTATGG - Intergenic
1055125511 9:72715081-72715103 TGAATATTGGCACTGTCTTCTGG + Intronic
1055173609 9:73290558-73290580 TGCATATATGGCATGGCTTCAGG - Intergenic
1057739843 9:97701520-97701542 TGGATACATTCCCTGTCATCCGG - Intergenic
1057770356 9:97961938-97961960 TTTATTTTTGCCCTGCCTTCTGG - Intergenic
1058795428 9:108493322-108493344 TGTATATATGCTCTGTCCACTGG - Intergenic
1059075664 9:111191225-111191247 TTTGTATTTGCTCTGTCTTCTGG - Intergenic
1203779735 EBV:94838-94860 TGTTTAAAGGCCCTGTCGTCGGG - Intergenic
1187219263 X:17308058-17308080 TGGATACATGCCCTGAGTTCTGG + Intergenic
1194925466 X:99818497-99818519 TTTTTAAATGGCCTGTCTTCAGG - Intergenic
1195436959 X:104855413-104855435 TGTATATTGGCCTTGGCTTCTGG - Intronic
1201917590 Y:19198957-19198979 TTTATAGAAGCCCTGTCTTCTGG - Intergenic