ID: 1017748067

View in Genome Browser
Species Human (GRCh38)
Location 6:157464924-157464946
Sequence GTCTTGGGTAACCAGCCTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 100}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017748059_1017748067 25 Left 1017748059 6:157464876-157464898 CCAGAGCAGCTCAGGGCGGGCCA 0: 1
1: 0
2: 1
3: 19
4: 183
Right 1017748067 6:157464924-157464946 GTCTTGGGTAACCAGCCTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 100
1017748061_1017748067 5 Left 1017748061 6:157464896-157464918 CCAGCTGTGGCTTCGTCGCAGCA 0: 1
1: 0
2: 0
3: 2
4: 72
Right 1017748067 6:157464924-157464946 GTCTTGGGTAACCAGCCTCTAGG 0: 1
1: 0
2: 0
3: 3
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017748067 Original CRISPR GTCTTGGGTAACCAGCCTCT AGG Intronic
905804369 1:40865078-40865100 GTCTTAGGTCACCAGCATTTGGG + Intergenic
906285587 1:44585617-44585639 CTCTTGTGTCACCAGCCCCTAGG - Intronic
907341125 1:53737209-53737231 GTCTTGGGTCACAAGCTCCTTGG - Intergenic
909708195 1:78612240-78612262 GTCTTGGCTATGCAGGCTCTTGG - Intergenic
910478551 1:87634293-87634315 GTCTTGGGAAACCCACCACTTGG + Intergenic
912549458 1:110475618-110475640 GTCCTGGTTGACCAGCCTATGGG + Intergenic
916507005 1:165437099-165437121 GTCATGGGGAAGCAGCCTCCTGG + Intronic
919346452 1:196385840-196385862 GTCTGTGGTAGCCAGCCTCCAGG + Intronic
923623789 1:235598007-235598029 GTCTTGGGTAGCCAGAGTCAGGG - Intronic
924432381 1:244008013-244008035 TTCTTGGGACACCATCCTCTAGG - Intergenic
1064653846 10:17537046-17537068 GTCTTGGACACCCAGCCTCAAGG + Intergenic
1066685219 10:37975561-37975583 GTCTTTAGAAACTAGCCTCTGGG + Intronic
1067807345 10:49402305-49402327 GCCCTGGGGAACCAGCCCCTAGG + Intergenic
1067854455 10:49780293-49780315 GCCCTGGGGAACCAGCCCCTAGG + Intergenic
1079053280 11:17182194-17182216 TACTTGGGTAACCAGTCACTAGG - Intronic
1079446233 11:20558618-20558640 GTCCTGGGTAGCCAGCACCTTGG + Intergenic
1080022132 11:27573272-27573294 GCCTTCTGTAACCACCCTCTGGG - Intergenic
1083362478 11:62120509-62120531 GTAATGTGTAACCAGACTCTTGG - Intergenic
1083743165 11:64721834-64721856 GTCTTGGGTCCCCAGTCCCTTGG - Intronic
1088303751 11:108386626-108386648 ATCTTAGGAAACCTGCCTCTTGG - Intronic
1089338748 11:117743572-117743594 GTCTGGCGTAACCACCCTCTGGG + Intronic
1108515928 13:51202589-51202611 TCCTTGGGTCACCAGCCTGTAGG - Intergenic
1114277341 14:21158720-21158742 GTCCTGGGAAATCAGCCTGTGGG + Intergenic
1114278027 14:21165520-21165542 GTCCTGGGAAATCAGCCTGTGGG - Intergenic
1117388896 14:55244139-55244161 ATCTTAGGGAACCAGCCACTGGG - Intergenic
1117866873 14:60159059-60159081 GTCTTGGGTAACAAACTTTTGGG - Intronic
1121221699 14:92290178-92290200 GTCTTGGGTCACCAGGAGCTGGG - Intergenic
1121730893 14:96186288-96186310 GCCCTGGGTTAGCAGCCTCTGGG + Intergenic
1122772880 14:104105073-104105095 CCCTTGGGTTGCCAGCCTCTGGG + Intronic
1122854324 14:104552913-104552935 GCCCTGGGTAACCTCCCTCTGGG + Intronic
1124025051 15:25958328-25958350 GACTTGGGTAACTATCCACTGGG + Intergenic
1124475517 15:30030216-30030238 TTAATGGGTAACCAGTCTCTAGG + Intergenic
1131153230 15:90059815-90059837 GCCTAAGGAAACCAGCCTCTTGG - Intronic
1137844395 16:51673163-51673185 GTCTTGGCTAACCAACAACTTGG + Intergenic
1142261712 16:89045549-89045571 GTCTCAGGTAACCAGTCTCAGGG + Intergenic
1145051294 17:19663660-19663682 GTCTTGGTTAATGAGACTCTGGG + Intronic
1145907908 17:28526373-28526395 GCCTTGGGAAACCAGCATCTGGG - Intronic
1148846803 17:50534339-50534361 GTGTGGGGGCACCAGCCTCTGGG - Intronic
1149004709 17:51793504-51793526 CTGTGGGGTATCCAGCCTCTTGG - Intronic
1152327190 17:79648358-79648380 TTCTTGGGTGACCTGCCTCTGGG - Intergenic
1153238722 18:3012726-3012748 GTCTCGGGTAACCATCCCCAGGG + Intronic
1158865742 18:61636314-61636336 GGCTGGGCTAAGCAGCCTCTGGG + Intergenic
1160567121 18:79793245-79793267 GTCTTGGGTGCTAAGCCTCTTGG - Intergenic
1161084577 19:2328869-2328891 GTCTTGGGGGTCCAGCCTCGGGG + Intronic
1161930765 19:7338013-7338035 GAATTGGGGAACCAGCCCCTGGG + Intergenic
926161605 2:10493837-10493859 CTGTTGAGTAACCATCCTCTCGG - Intergenic
926273482 2:11385895-11385917 GTCTGGGCTTACCAGCCTGTGGG + Intergenic
927968505 2:27287989-27288011 GGCTTGGTTTACCAGCCCCTTGG + Intronic
928633777 2:33221301-33221323 ACCTTGGGAAACAAGCCTCTTGG - Intronic
934716724 2:96549075-96549097 CTCTGGGGTACCCAGCCTCCGGG + Intronic
938841509 2:135169099-135169121 CTCTTCTGTGACCAGCCTCTAGG + Exonic
942938797 2:181591852-181591874 GTATTGGGAAACCAACATCTGGG - Intronic
946573677 2:221051333-221051355 GTCTGGGGTCACCATTCTCTCGG - Intergenic
1174127701 20:48319402-48319424 GTCATGGAGAACCAGCTTCTTGG - Intergenic
1174316133 20:49703394-49703416 GTCTGGGCAGACCAGCCTCTTGG - Intronic
1178414548 21:32393158-32393180 GTCTTGGGGATCCAGAGTCTTGG + Exonic
1180092171 21:45538743-45538765 GTCTAGGGTAACCTGCCGCCGGG - Intronic
1184108282 22:42381267-42381289 ATCCTGGGAAACCAGCTTCTGGG - Exonic
1184960047 22:47922102-47922124 GTCCTGGGGAACCAGGCTCCAGG - Intergenic
950193146 3:10992041-10992063 GCCTGGGGTGACCAGGCTCTGGG - Intergenic
950857841 3:16121988-16122010 CTCTTGGTTAACCAGCCCCAGGG + Intergenic
952363744 3:32656375-32656397 GTCTTTGAAAACCATCCTCTGGG + Intergenic
953548963 3:43885759-43885781 GTCTTAGCTATTCAGCCTCTTGG - Intergenic
958499056 3:94882407-94882429 GCCTTAGGTACCCAGTCTCTTGG + Intergenic
959459688 3:106609903-106609925 GTCTGGAATAAACAGCCTCTTGG + Intergenic
961703613 3:128766374-128766396 GTCCTGGGTAACCACCGTCATGG + Intronic
963652248 3:147994586-147994608 CTCTTGGGGAACCAGCCACCAGG + Intergenic
965440549 3:168707746-168707768 GTCTGTGATAACCAACCTCTAGG - Intergenic
965564657 3:170101729-170101751 GTCTTTAGTAGCCAGCCCCTTGG + Intronic
965620891 3:170641457-170641479 GTCTTGGGGAGTCAGGCTCTGGG - Intronic
970460587 4:16270799-16270821 TTCTTGGGGAAGGAGCCTCTGGG + Intergenic
972705856 4:41541859-41541881 GACTTTGGTAAACAGCCCCTTGG + Intronic
974626406 4:64432552-64432574 GTCTTGGGTGACAAGTCTTTGGG + Intergenic
983417398 4:167476116-167476138 TGCTTGGGCTACCAGCCTCTTGG + Intergenic
988042881 5:25911231-25911253 GTAATGGGCACCCAGCCTCTAGG + Intergenic
991940027 5:71841676-71841698 GTCCAGGGTCACCAGGCTCTTGG + Intergenic
994377963 5:99037292-99037314 CTCTTGGGTTATCAGCCTCCTGG + Intergenic
995907824 5:117147003-117147025 GTCTTCACTAACCAGCCTTTGGG + Intergenic
1003409953 6:5853250-5853272 GTCTTGGATTTCCAGCCTCCAGG + Intergenic
1004341200 6:14808965-14808987 GTGTTGGGTAACCTTCCTTTAGG - Intergenic
1006669482 6:35720728-35720750 GTCTTGGGTCCCCAGCTCCTTGG + Intronic
1007736008 6:43982609-43982631 GCCCTGGGGAACCAGCTTCTAGG + Intergenic
1010010959 6:71047683-71047705 CTCTTGGGTAATGAGCCGCTGGG + Intergenic
1012972700 6:105748755-105748777 GTAGTGGGAAACCAGCCTCCAGG - Intergenic
1014302386 6:119698580-119698602 GCCTTGGGAGCCCAGCCTCTAGG - Intergenic
1017748067 6:157464924-157464946 GTCTTGGGTAACCAGCCTCTAGG + Intronic
1020025673 7:4898213-4898235 GTTCTGGGTAACCAGATTCTTGG + Intergenic
1023008526 7:35902873-35902895 GTCTTGGGTCACTGGCCTTTTGG + Intronic
1032303282 7:130709462-130709484 TTCTTGGGTACCCAGGCTTTTGG + Intergenic
1037751321 8:21684229-21684251 TTCTTGGGAAGCCAACCTCTGGG - Intergenic
1044787049 8:95805472-95805494 TTCCTGGGTGACCATCCTCTGGG + Intergenic
1047965445 8:130042812-130042834 GTCTAGGGGAAACAGCCTTTTGG - Intergenic
1055401343 9:75927503-75927525 GTCTTGGGTAAACTGTCTGTGGG + Intronic
1060032640 9:120228649-120228671 GACTTGGGTACCCAGTGTCTGGG + Intergenic
1062160672 9:135077932-135077954 GACTAGGGTAGCCAGGCTCTCGG - Intronic
1188187577 X:27133523-27133545 GTCCTGGGTAACCAGACACATGG - Intergenic
1189850664 X:45173342-45173364 GGCTTGGGTAGGCAGCTTCTGGG + Intronic
1190247293 X:48699052-48699074 GTCTGGGGTGACCATGCTCTGGG + Intronic
1191870288 X:65739890-65739912 GTAATGGGCACCCAGCCTCTAGG + Exonic
1195135782 X:101906446-101906468 GTCTGTGGGTACCAGCCTCTTGG - Intronic
1199615028 X:149649378-149649400 GTCTTGGGTGAGCAGCTTCCTGG + Intergenic
1199623142 X:149716550-149716572 ATTTTGGGTAAGGAGCCTCTTGG - Exonic
1200078296 X:153562842-153562864 GCCTTGGATATCCAGCCTCCGGG - Intronic
1200409503 Y:2847338-2847360 GTCTTGGGAAAACAGCCTGATGG + Intronic