ID: 1017750434

View in Genome Browser
Species Human (GRCh38)
Location 6:157486330-157486352
Sequence CAGGTAGGAGATGCTGTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 771
Summary {0: 1, 1: 0, 2: 2, 3: 61, 4: 707}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017750434_1017750439 7 Left 1017750434 6:157486330-157486352 CCAAGCACAGCATCTCCTACCTG 0: 1
1: 0
2: 2
3: 61
4: 707
Right 1017750439 6:157486360-157486382 TTGGGCAGTCGACAAATTTCTGG 0: 1
1: 0
2: 0
3: 5
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017750434 Original CRISPR CAGGTAGGAGATGCTGTGCT TGG (reversed) Intronic
900191464 1:1354014-1354036 CAGCTAGGTGAGGCAGTGCTGGG - Exonic
900219143 1:1497886-1497908 CAGGCGTGAGCTGCTGTGCTGGG - Intergenic
900350833 1:2233750-2233772 CAGGAAGGGGTTGCTGGGCTTGG + Intronic
900948977 1:5846906-5846928 CAGCTAAGAGGTGCTGAGCTGGG - Intergenic
901503962 1:9672331-9672353 CTGGTTGGAGTCGCTGTGCTGGG - Intronic
901547028 1:9965723-9965745 CAGGCATGAGCTACTGTGCTTGG - Intronic
902506775 1:16943819-16943841 CAGGTAGAAGAGGCCGAGCTAGG - Intronic
902636131 1:17736179-17736201 CAGGGAGCAGGTGCTGGGCTTGG + Intergenic
903370416 1:22831737-22831759 TAGGTGGGAGATGCTGACCTGGG + Intronic
903465126 1:23546679-23546701 CAGGTATGAGCCACTGTGCTCGG - Intergenic
903508945 1:23859057-23859079 CAGGCATGAGCTGCTATGCTTGG + Intronic
903782025 1:25826824-25826846 CAGGTAGGAGCCCCTGTGCCAGG + Exonic
904056501 1:27674111-27674133 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
904308904 1:29612514-29612536 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
904403276 1:30270693-30270715 CAGGTAGGAGATGATGAGGCAGG - Intergenic
904717020 1:32476093-32476115 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
905152705 1:35944325-35944347 CAGGCACAAGATGCTGTGCCTGG + Intronic
905356179 1:37386468-37386490 CAGGTATGAGTAACTGTGCTTGG - Intergenic
905659566 1:39711065-39711087 CAGGTATGAGCTGCTGTGTCTGG - Intronic
905669159 1:39779686-39779708 GAGGCGGGAGATGCTGTGCCAGG + Intronic
906145907 1:43560587-43560609 GAGGTCGGAGATGCTGTGTCTGG + Intronic
906179744 1:43808024-43808046 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
906213020 1:44022632-44022654 CAGATAGAAGATCCTGAGCTTGG + Intronic
906226289 1:44124771-44124793 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
906282115 1:44561637-44561659 CAGGCATGAGCTGCTGTGCCTGG - Intronic
906473992 1:46155040-46155062 CAGGTAGGAGCCACTGTGCCTGG - Intronic
906970564 1:50509332-50509354 CAGACATGAGATGCTGTGCCTGG - Intronic
907122895 1:52023058-52023080 CAGGTATGAGCCACTGTGCTCGG + Intronic
907273583 1:53304763-53304785 CTGGTTGGAGGTGCTGAGCTGGG - Intronic
907447294 1:54516700-54516722 CAGTTGGGAGAGGCTGGGCTGGG - Intergenic
907522607 1:55034076-55034098 CCTGTGGGACATGCTGTGCTGGG - Intergenic
908072333 1:60475494-60475516 CATATAGCAGATGCTATGCTAGG - Intergenic
908588274 1:65598298-65598320 CTGGTAGAAAATGCTGTGCAGGG - Intronic
909927081 1:81449866-81449888 CAGGCATGAGACACTGTGCTTGG + Intronic
911602634 1:99863213-99863235 TAGGCATGAGCTGCTGTGCTTGG + Intronic
911681236 1:100718321-100718343 TAAGTTGGAGATGCTGTTCTAGG - Intergenic
912410172 1:109475727-109475749 CAAGTGAGAGATGATGTGCTGGG - Intronic
912789453 1:112637728-112637750 CAGGTGTGAGCTGCTGTGCTGGG + Intronic
913329920 1:117658825-117658847 CATGAAGGAGACCCTGTGCTGGG + Intergenic
915041256 1:152969942-152969964 CAGGTAGAAGATGATGTGAATGG - Intergenic
915249111 1:154576091-154576113 CAGGTTGGAGCTGCTGTGTGTGG - Exonic
915300198 1:154947387-154947409 CAGGCAGGAGGGGCTGGGCTAGG - Intronic
915300688 1:154949904-154949926 CAGGCAGGAGGGGCTGGGCTAGG - Intronic
915481707 1:156190894-156190916 CAGGCATGAGCTACTGTGCTGGG - Intergenic
915786937 1:158623867-158623889 CAGGTAGGGGTTCCTGGGCTGGG + Intronic
917151052 1:171945145-171945167 CAGGTATGAGCTACTGTGCCTGG + Intronic
917444055 1:175091865-175091887 CAGGTATGAGCTGTTGTGCCTGG + Intronic
917455316 1:175181127-175181149 CAGGCATGAGACACTGTGCTTGG + Intronic
918706975 1:187675842-187675864 CAGGCATGAGATACTGTGCCTGG - Intergenic
919096109 1:193038716-193038738 CAGGTGTGAGCTACTGTGCTTGG - Intronic
920503256 1:206498824-206498846 CATGGAGGAGGTGCTATGCTAGG + Intergenic
921167582 1:212518018-212518040 CAGGTATGAGACACTGTGCTTGG - Intergenic
921380414 1:214518989-214519011 CAGGCATGAGCTGCTGTGCCTGG - Intronic
921664704 1:217854676-217854698 CAGCTAGTAGATGCTGTGCCAGG - Intronic
922087010 1:222359468-222359490 CAGGTATGAGCCGCTGTGCCCGG - Intergenic
922371455 1:224914625-224914647 CAGGGAGGACATCCTGGGCTTGG - Intronic
923113052 1:230908465-230908487 CAGGTATGAGCTACTGTGCCTGG + Intronic
923297346 1:232607776-232607798 CAGGCATGAGATACTGTGCCCGG - Intergenic
923672767 1:236054917-236054939 CAGGTATGAGCCACTGTGCTCGG + Intronic
924214497 1:241806826-241806848 CTGGTAGGAGATGCTGATATTGG + Intergenic
1062871041 10:904754-904776 CAGTGAGGAAATGATGTGCTCGG - Intronic
1062945039 10:1454142-1454164 CAGGTAGGAGAGCGTGTGCAGGG + Intronic
1063011961 10:2031188-2031210 CAAGTAGGAGATGCTTCACTTGG - Intergenic
1063327774 10:5122200-5122222 CAGGTAGAAGCTGCTGTCCTGGG - Intronic
1063342063 10:5275271-5275293 CAGGAAGAAGCTGCTGTCCTGGG - Intergenic
1063674776 10:8130993-8131015 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1063700712 10:8382538-8382560 CAGGTGTGAGTTGCTGTGCCCGG + Intergenic
1063981284 10:11453817-11453839 CAGGCATGAGCCGCTGTGCTTGG + Intergenic
1064099443 10:12451004-12451026 CATGTAAGAGGTGCGGTGCTGGG + Intronic
1064150928 10:12864039-12864061 CAGGTATGAGCTGCTGCGCCTGG + Intergenic
1064387235 10:14907125-14907147 CAGGCAGGAGTTACTGTGCCTGG + Intronic
1064476895 10:15700317-15700339 GAGGCAGGAGATGCTGAGATTGG - Intronic
1065473707 10:26111143-26111165 CAGGCATGAGGTGCTGTGCCTGG + Intronic
1066483625 10:35822735-35822757 CATGTGTCAGATGCTGTGCTGGG + Intergenic
1067023414 10:42821828-42821850 CAGGTATGAGCCACTGTGCTCGG + Intronic
1067344015 10:45425130-45425152 CAGGTAGGGGTTGATGGGCTGGG + Exonic
1067701609 10:48577281-48577303 CAGGCAGCAGATACTGTGCAGGG - Intronic
1067857344 10:49806228-49806250 CAGGTGTGAGATGCTGCGCCTGG - Intergenic
1067894497 10:50164315-50164337 CAGGTGCCAGATACTGTGCTAGG - Intergenic
1067954346 10:50775946-50775968 CAGGTGCCAGATACTGTGCTAGG + Intronic
1068085640 10:52370216-52370238 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1068570823 10:58626825-58626847 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1068716355 10:60193377-60193399 CAGGCATGAGCTACTGTGCTAGG - Intronic
1068985092 10:63100927-63100949 CAGGTATGAGCTGCCGTGCCTGG - Intergenic
1069831420 10:71284492-71284514 CAGGTAGAAGATGCATTGGTGGG + Intronic
1069878956 10:71579903-71579925 CAGGAAGGGGGTGCTGGGCTGGG + Intronic
1070384978 10:75916301-75916323 CAGGCAGGACATGCAGTGCCTGG + Intronic
1070572750 10:77652823-77652845 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1070720996 10:78757033-78757055 CAGAAAGCAGATGCCGTGCTGGG - Intergenic
1070888750 10:79926674-79926696 CAGGTATGAGCTACTGTGCCCGG + Intergenic
1071562440 10:86654878-86654900 CAGGCTGGAGATGCTGCTCTGGG - Exonic
1071866013 10:89732398-89732420 CAGGCAGGAGCCCCTGTGCTTGG + Intronic
1072094589 10:92165167-92165189 CAGGTATGAGCCACTGTGCTAGG - Intronic
1072524694 10:96261120-96261142 CAGGTATGAGCTACTGTGCCTGG + Intronic
1072909792 10:99489813-99489835 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1074034365 10:109723491-109723513 CAGGCAGCAGGTGCTGTCCTTGG + Intergenic
1075464039 10:122638103-122638125 CAAGTGGCAGATGCTGTGATTGG + Intronic
1075705993 10:124501322-124501344 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1076586947 10:131555838-131555860 CAGGTGTCAGAAGCTGTGCTGGG + Intergenic
1076989194 11:261261-261283 CAGGCATGAGCTACTGTGCTTGG - Intergenic
1077599390 11:3563424-3563446 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1079074640 11:17376650-17376672 CAGGGAGGAAATGCTTTCCTGGG - Exonic
1079076277 11:17387177-17387199 CAGGTAGGAGGTGCGGGCCTGGG + Exonic
1079377995 11:19911154-19911176 CATGTGCCAGATGCTGTGCTTGG + Intronic
1079588612 11:22155497-22155519 CAGGCAGGAGAGCCTGTGCAGGG + Intergenic
1080016303 11:27510424-27510446 CAGGTATGAGCTACTGTACTTGG - Intergenic
1080057435 11:27920684-27920706 CAGGTGTGAGACGCTGTGCCTGG + Intergenic
1080456561 11:32424898-32424920 CAGGTGTGAGCCGCTGTGCTGGG - Intronic
1080493105 11:32788741-32788763 CAGGCATGAGCTACTGTGCTTGG + Intronic
1080734336 11:34997023-34997045 CAGGCATGAGCTACTGTGCTAGG + Intronic
1082731465 11:56803238-56803260 CAGGTATGAGCTACTGTGCTGGG - Intergenic
1083058443 11:59845558-59845580 CAGTTAGGAGAGGCTGGGTTGGG - Intergenic
1083249607 11:61457474-61457496 CAGGTGTGAGATGCTGTGCCTGG - Intronic
1083403693 11:62442266-62442288 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1083609885 11:63999684-63999706 CAGGTAGCAGCTGCGGAGCTCGG + Exonic
1083774827 11:64889254-64889276 CAGGGAGGGGTTGCTGAGCTGGG + Intergenic
1084255295 11:67938029-67938051 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1084341893 11:68510030-68510052 CAGGTGTGAGCTACTGTGCTCGG + Intronic
1084411742 11:69009770-69009792 GGGGGAGGAGATGCTGGGCTGGG + Intronic
1084817453 11:71657266-71657288 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1084991991 11:72934609-72934631 CAGGCATGAGCTGCTGTGCTTGG + Intronic
1085264645 11:75230007-75230029 CAGGCAGGAGAGGCTGAGCCAGG - Intergenic
1085445118 11:76596339-76596361 CAGGCATGAGCTGCTGTGCCCGG + Intergenic
1085692506 11:78675142-78675164 CAGGTATGAGCTGCTGTGCCTGG + Intronic
1086404236 11:86486505-86486527 CTGGTTGGAGAAGCTGAGCTTGG + Intronic
1086900709 11:92364980-92365002 TAGGCATGAGCTGCTGTGCTTGG - Intronic
1087196202 11:95306396-95306418 CAGGTAAGACATGCCTTGCTTGG - Intergenic
1087476061 11:98636951-98636973 CAGGCATGAGCTACTGTGCTAGG - Intergenic
1087646023 11:100809270-100809292 AAGGTAGGAGAGGCTCTGATTGG + Intronic
1087855438 11:103087046-103087068 CAGGCATGAGCTGCTGTGCTTGG - Intronic
1087995945 11:104809309-104809331 CAGATAGTAGATACTGTGTTAGG - Intergenic
1088263994 11:107972348-107972370 CAGGAATGAGCTACTGTGCTTGG + Intergenic
1088553797 11:111040878-111040900 AACATAGCAGATGCTGTGCTTGG - Intergenic
1088594735 11:111432364-111432386 CAGGCATGAGACACTGTGCTTGG - Intronic
1088691809 11:112334796-112334818 CAGGGAGGGGAAGCTGAGCTGGG + Intergenic
1088909740 11:114181845-114181867 GAGGTGGGAGATGCGGGGCTGGG - Intronic
1089119546 11:116124150-116124172 CAGGTAGTAGAGGCTGAGCCTGG - Intergenic
1089241036 11:117079889-117079911 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1089476609 11:118768730-118768752 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1089553422 11:119299777-119299799 CAGCAGGGAGATGGTGTGCTAGG - Exonic
1089683639 11:120133383-120133405 CAAGTAGGACATGCTGGGCCCGG + Intronic
1089971569 11:122697820-122697842 GAGGAAGCAGCTGCTGTGCTGGG + Intronic
1090443502 11:126744111-126744133 CAGGAAGGTGGAGCTGTGCTTGG + Intronic
1090452124 11:126815810-126815832 CAGGCATGAGCTGCTGTGCCCGG + Intronic
1090692158 11:129195255-129195277 CAGGTATGAGCTACTGTGCCCGG + Intronic
1091742375 12:2968931-2968953 CAGGTATGAGCCACTGTGCTGGG + Intronic
1092161420 12:6317411-6317433 CAGGTGGGAGAAGGGGTGCTGGG + Exonic
1092425529 12:8372769-8372791 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1092940248 12:13401349-13401371 CAGGTAAAAGGTGATGTGCTGGG + Intergenic
1093253790 12:16840746-16840768 CAGGTAGGAGATACAATGGTTGG + Intergenic
1095081507 12:38005128-38005150 CAGGTTGGAAATGCTGTTTTTGG + Intergenic
1095629895 12:44363304-44363326 CATGTAGTAGATTCTGTACTAGG - Intronic
1095687960 12:45056846-45056868 CAGGCATGAGCTGCTGCGCTGGG + Intergenic
1096006830 12:48180281-48180303 CAGGAAGCAGAAGCTGTGCGGGG + Intronic
1096054132 12:48636846-48636868 TAGGAAGGAGATGCTGGGCACGG + Intergenic
1096146272 12:49281164-49281186 CAGGTATGAGCCACTGTGCTTGG + Intergenic
1096409795 12:51368935-51368957 CAGGTGCCAGATGCTGTTCTGGG + Intronic
1096410548 12:51374135-51374157 CAGGCATGAGCTACTGTGCTTGG + Intronic
1096972426 12:55678441-55678463 CAGGTATGAGCTGCCGTGCCCGG - Intergenic
1100376318 12:94019097-94019119 CATGTTGAAGATGCTGAGCTTGG - Intergenic
1100548752 12:95627440-95627462 GAGGTAGCACATGCTGTGCGAGG - Intergenic
1100845560 12:98654682-98654704 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1101819250 12:108170816-108170838 CAGCTAGGAGTGGCTGAGCTGGG + Intronic
1102124216 12:110467576-110467598 CATTTAGGAGAAGTTGTGCTCGG - Intronic
1102528236 12:113527344-113527366 CAGGTGTGAGCTACTGTGCTCGG + Intergenic
1102947883 12:117005938-117005960 AGGTTAGGAGGTGCTGTGCTGGG - Intronic
1103028221 12:117591490-117591512 GAGATAGGAGATGCCCTGCTAGG + Intronic
1103419036 12:120765254-120765276 CAGGCATGAGCTGCTGCGCTTGG + Intronic
1103490136 12:121311553-121311575 CAGGCATGAGATACTGTGCCTGG - Intronic
1103632873 12:122276928-122276950 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1103652126 12:122441099-122441121 CAGGCTTGAGCTGCTGTGCTCGG + Intergenic
1104452818 12:128885030-128885052 CAGGTGTGAGCTACTGTGCTTGG + Intronic
1104778934 12:131407372-131407394 GAGGTAGGACATCCTGTTCTAGG - Intergenic
1104840206 12:131820550-131820572 CAGGTGTGAGACACTGTGCTTGG - Intergenic
1105478809 13:20754629-20754651 CAGGCAGGAGCTACTGTGCCCGG - Intronic
1105972200 13:25439631-25439653 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1106220199 13:27740574-27740596 CAGGTGTGAGTCGCTGTGCTTGG - Intergenic
1106274438 13:28190535-28190557 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1106310008 13:28545663-28545685 CAGGAAGTAGATTCTGAGCTTGG + Intergenic
1106409602 13:29502117-29502139 CACATAGGAAAGGCTGTGCTGGG + Intronic
1107368765 13:39717587-39717609 CAGGTGTGAACTGCTGTGCTTGG - Intronic
1107572546 13:41678171-41678193 CAGGTATGAGCTGCAGAGCTAGG + Intronic
1107701490 13:43052692-43052714 CAGGCATGAGACACTGTGCTCGG + Intronic
1107942656 13:45388429-45388451 CAGGCAGGAGCTGCTGTTCCTGG - Intergenic
1108210793 13:48137966-48137988 CAGGTATCACATGCAGTGCTAGG - Intergenic
1109641066 13:65192334-65192356 GAGGTAGAACATGCTGTGTTTGG - Intergenic
1109781749 13:67119769-67119791 CAACTAGGACATGCTGTGGTGGG + Intronic
1110398147 13:75057067-75057089 CAGGCATGAGCTGCTGTGCCCGG - Intergenic
1110684687 13:78358253-78358275 CAGGTAGCAGATGCTGACATAGG + Intergenic
1110756731 13:79183763-79183785 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
1111714745 13:91866143-91866165 CAGGCATGAGCTACTGTGCTCGG + Intronic
1111772832 13:92621541-92621563 CAGGTGTGAGCTACTGTGCTTGG - Intronic
1111936955 13:94567442-94567464 CAATTAGGAGATGTTGAGCTTGG - Intergenic
1112442307 13:99433274-99433296 CAGGTATGAGACACTGTGCTGGG - Intergenic
1112465696 13:99642706-99642728 CAGGAAGGAGAGGCTGGGCATGG - Intronic
1112594709 13:100797185-100797207 CAGGTATGAGCCACTGTGCTGGG - Intergenic
1113033670 13:106024290-106024312 CAGGTAAGAGAGGTTGTGCAGGG - Intergenic
1113490671 13:110689269-110689291 CAGGTGGCAGGTGCTGTGCTTGG - Intronic
1113561864 13:111287597-111287619 CAGGTGGGAGATTCGGTGCCAGG + Intronic
1113784363 13:112994713-112994735 CAGGCAGGAGAGCCTGTGCCCGG - Intronic
1113909154 13:113833952-113833974 CAGGTAGGTCATGCTGTGACAGG + Intronic
1113909169 13:113834029-113834051 CAGGTAGGTCATGCTGTGATAGG + Intronic
1113909180 13:113834091-113834113 CAGGTAGGTCATGCTGTGATAGG + Intronic
1113909196 13:113834168-113834190 CAGGTAGGTCATGCTGTGACAGG + Intronic
1113987190 13:114327611-114327633 CAGGATTGAGATGCTGTACTGGG + Intergenic
1114319097 14:21532005-21532027 CAGGCATGAGCTGCTGTGCCCGG + Intronic
1114580686 14:23756671-23756693 CAGGCTGGAGGTGCTGGGCTGGG - Intergenic
1114631014 14:24159737-24159759 AAAGCAGGAGTTGCTGTGCTCGG + Intronic
1114760436 14:25308300-25308322 CAGGTCTGAGATCCTGTCCTAGG - Intergenic
1115170875 14:30505369-30505391 CAGGAAGCAGAGGCTGTGGTTGG - Intergenic
1115585770 14:34811416-34811438 CAGGCATGAGACACTGTGCTTGG + Intronic
1115647554 14:35380035-35380057 CAGGTATGAGCTACTGTGCTTGG - Intergenic
1115655147 14:35436689-35436711 CAGGTATGAGCCACTGTGCTTGG + Intergenic
1116629033 14:47305675-47305697 CAGGCATGAGACTCTGTGCTGGG + Intronic
1116746693 14:48829761-48829783 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1117171489 14:53104218-53104240 CAGGTATGAGCTGCTGCGCCTGG + Intronic
1117302413 14:54442761-54442783 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1117675294 14:58149632-58149654 CAGGGATGAGATGATATGCTAGG - Intronic
1117934857 14:60891728-60891750 CAGGTGTGAGACACTGTGCTTGG + Intronic
1118013416 14:61633587-61633609 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1118773764 14:68960631-68960653 CAGGTAGGAGCCACTGTGCCTGG - Intronic
1119148097 14:72334298-72334320 CAGCTAGGAGGGGCTGTGCTTGG - Intronic
1119200764 14:72750911-72750933 CAGGCAGGAGCTACTGTGCCTGG - Intronic
1119204653 14:72785006-72785028 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1119511985 14:75218948-75218970 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1119649248 14:76372048-76372070 CTGGCAAGAGTTGCTGTGCTGGG + Intronic
1119723194 14:76905432-76905454 CAGGCAGGAGCCACTGTGCTCGG - Intergenic
1119890064 14:78175688-78175710 CAGGTTGGCCATGCTGAGCTCGG + Intergenic
1120875066 14:89367970-89367992 AAGGTAGGAGCTGCTGACCTCGG + Intronic
1121813146 14:96908990-96909012 CAGGCAAGAGAACCTGTGCTGGG + Intronic
1122059121 14:99124805-99124827 CAGGTGGGAAATGCTGCCCTGGG + Intergenic
1122532245 14:102436595-102436617 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1124019058 15:25903257-25903279 CAGGTAGGACAGGGTGTGCCCGG - Intergenic
1124066455 15:26348414-26348436 CAGGCATGAGCTGCTGTGCCCGG - Intergenic
1124462831 15:29908739-29908761 CAGGCATGAGCTGCTGTGCCCGG - Intronic
1124472111 15:29996905-29996927 CTGGCCGGAGATGCTGTCCTGGG + Intergenic
1124650360 15:31469464-31469486 CAGGTAGGAGCTGCCCTCCTGGG - Intergenic
1124891389 15:33737035-33737057 CAGGTATGAGCTACTGTGCCTGG + Intronic
1125262156 15:37838939-37838961 CAGGTAGAAGATCCACTGCTTGG + Intergenic
1126102279 15:45126145-45126167 CAGGTAAGAGAGGATGAGCTTGG - Intronic
1126171617 15:45699829-45699851 CAGGCATGAGCTGCTGTGCCCGG - Intergenic
1126456815 15:48871602-48871624 CATGGAGGAAATGCTGAGCTGGG - Intronic
1127483141 15:59395682-59395704 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1127505009 15:59589888-59589910 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1127567351 15:60204703-60204725 GAGGGAGGAGATTCTTTGCTTGG + Intergenic
1127949229 15:63788241-63788263 TAGGTATCAGATGCTGTGTTAGG - Intronic
1127996162 15:64154072-64154094 CAGGAAGGAGATGCTGTCTGAGG - Intronic
1128016002 15:64347728-64347750 CAGGTAGGAGCCACTGTGCCTGG - Intronic
1128274267 15:66339386-66339408 CAGGCAAGAGACACTGTGCTGGG + Intronic
1128430705 15:67590729-67590751 CAGGCTTGAGACGCTGTGCTTGG + Intronic
1129216997 15:74106283-74106305 CAGGTGGTAGAAGCTGAGCTAGG - Intronic
1129245648 15:74277299-74277321 CTGGGAGCAGATGCTGGGCTGGG - Intronic
1129317233 15:74752324-74752346 CGGGAAGGAGATGCTGAGCCAGG - Intronic
1129367896 15:75068218-75068240 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1129377535 15:75143571-75143593 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1129540872 15:76346368-76346390 CAGGTAGGAGAGGCTGCCCAAGG - Intergenic
1129798166 15:78393776-78393798 CAGGCATGAGCTGCTGTGCCCGG + Intergenic
1130266796 15:82412884-82412906 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1130348897 15:83073210-83073232 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1130505228 15:84533994-84534016 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1131033416 15:89205444-89205466 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1131214390 15:90525143-90525165 CAGGTATGAGCCACTGTGCTTGG - Intergenic
1131377842 15:91940154-91940176 CAGGCAGGAGCTGCTGTCATTGG - Intronic
1131642757 15:94310507-94310529 CAGATATGAGCTACTGTGCTTGG - Intronic
1131815463 15:96217104-96217126 CAGGGAGGACATGGTGTCCTGGG - Intergenic
1132670467 16:1100393-1100415 CAGGTGGAAGATGCTGCGCGGGG - Intergenic
1132677095 16:1125325-1125347 CAGTGAGGAGAGGCCGTGCTGGG - Intergenic
1132731201 16:1362874-1362896 CGTGTAGGGGATGCCGTGCTGGG - Exonic
1132870842 16:2115133-2115155 CAGGAAGGAGCAGCTGTGCTGGG + Intronic
1132958231 16:2607826-2607848 CAGTCAGGAGAGGCTGTGCCTGG + Intergenic
1133284531 16:4684407-4684429 CAGGTACCACACGCTGTGCTGGG + Intronic
1133641360 16:7720515-7720537 CAGGCAGGAGCTACTGTGCCTGG - Intergenic
1133740000 16:8644211-8644233 CAGGCACCAGATTCTGTGCTGGG + Intronic
1133841228 16:9411527-9411549 CAGGTTGGAGATGGAGTCCTAGG - Intergenic
1134097976 16:11431681-11431703 CAGGCATGAGCTGCTGTGCCTGG + Intronic
1134521688 16:14921771-14921793 CAGGAAGGAGCGGCTGTGCTGGG - Intronic
1134541802 16:15073186-15073208 CAGGCAGGAGCCACTGTGCTTGG - Intronic
1134631380 16:15758524-15758546 CAGGTATGAGCCACTGTGCTTGG - Intronic
1134709358 16:16320422-16320444 CAGGAAGGAGCGGCTGTGCTGGG - Intergenic
1134716570 16:16360451-16360473 CAGGAAGGAGCGGCTGTGCTGGG - Intergenic
1134950244 16:18348223-18348245 CAGGAAGGAGCGGCTGTGCTGGG + Intergenic
1134958180 16:18391708-18391730 CAGGAAGGAGCGGCTGTGCTGGG + Intergenic
1135740964 16:24974867-24974889 CAGGCATGAGCTACTGTGCTGGG - Intronic
1136169803 16:28482179-28482201 CAGGTACCAGATGCTGTACCAGG - Exonic
1136173231 16:28500685-28500707 CAGGAGGCAGACGCTGTGCTGGG + Intronic
1136374879 16:29859422-29859444 TAGGTAGGAGATGAGGGGCTGGG - Exonic
1137061938 16:35798850-35798872 CAGCTAAGAGATGCTGTTTTAGG + Intergenic
1137278442 16:46953727-46953749 CAGGTATGAGCCACTGTGCTCGG - Intergenic
1137422058 16:48343419-48343441 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1137426073 16:48382097-48382119 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1137651560 16:50124840-50124862 CAGGAAGGAGCCGCTGTGCCTGG + Intergenic
1137935950 16:52635720-52635742 CAGGTGTGAGACACTGTGCTTGG - Intergenic
1138001801 16:53288584-53288606 CAGGTAGGATTTGCTGGACTTGG + Intronic
1138444764 16:57056558-57056580 CAGGCATGAGCCGCTGTGCTTGG + Intronic
1138473601 16:57257630-57257652 CTGGGAGGAGATGGTGTGCAGGG + Intronic
1138676833 16:58657441-58657463 CAGGTGTGAGCTGCTGTGCCAGG + Intergenic
1139159163 16:64482129-64482151 GAGGAAGGTGATGCTTTGCTAGG + Intergenic
1139505208 16:67395167-67395189 CAGGTAGGAGGGACTGTGCTGGG - Exonic
1140114987 16:72034202-72034224 CAGGTATGAGCTGCAGTGCCTGG - Intergenic
1140143856 16:72286380-72286402 CATGAAGGAGATGGAGTGCTAGG - Intergenic
1140351125 16:74262934-74262956 CAGGTATGAGCTACTGTGCACGG + Intergenic
1140581134 16:76232107-76232129 CAGGCGTGAGATTCTGTGCTTGG + Intergenic
1140749051 16:78006874-78006896 CAGGTATGAGACGCTGCACTTGG - Intergenic
1140864442 16:79047930-79047952 CAGACAGGAGATTTTGTGCTAGG - Intronic
1142359751 16:89620445-89620467 CAGGCAGGAGAGCTTGTGCTGGG - Intronic
1142893216 17:2958401-2958423 CAGGTAAGAGCTGCTGCCCTGGG + Intronic
1143185924 17:5010201-5010223 CAGGTGTGAGCTACTGTGCTTGG + Intronic
1143456727 17:7072685-7072707 CAGGTATGAGCTGCAGTGCTTGG - Intergenic
1143475717 17:7202937-7202959 CAGGTAGGCATTGCTGGGCTTGG + Exonic
1143902371 17:10183886-10183908 CAGGTAGCAGGGGCTGAGCTGGG + Intronic
1144622510 17:16826714-16826736 CAGGCATGAGATGCTGTGCCCGG + Intergenic
1144673403 17:17145818-17145840 GAGGAAGGAGATGCTGGGCTTGG - Intronic
1144883918 17:18445996-18446018 CAGGCATGAGATGCTGTGCCCGG - Intergenic
1145010676 17:19365981-19366003 TAGGTAGGAGATGATGAGCTAGG - Intronic
1145108439 17:20140011-20140033 TGGGTAAGAGATGCTGTGTTGGG - Intronic
1145116789 17:20217770-20217792 CAGGCATGAGCTGCTGTGCCTGG - Intronic
1145148314 17:20498381-20498403 CAGGCATGAGATGCTGTGCCCGG + Intergenic
1145273357 17:21416271-21416293 CAGGTAGGAGCTGCGGGCCTGGG - Exonic
1145311546 17:21703715-21703737 CAGGTAGGAGCTGCGGGCCTGGG - Exonic
1145720605 17:27068349-27068371 CAGGAAGTACATGCTTTGCTGGG + Intergenic
1146901663 17:36592816-36592838 CAGGGAGGAATTTCTGTGCTAGG + Intronic
1147576847 17:41606634-41606656 CAGGCATGAGTTGCTGTGCCCGG + Intergenic
1147973043 17:44230121-44230143 CTGGTGTGTGATGCTGTGCTGGG - Intergenic
1148281873 17:46354672-46354694 CAGGTGTGAGCTACTGTGCTCGG - Intronic
1148304098 17:46572611-46572633 CAGGTGTGAGCTACTGTGCTCGG - Intronic
1148429635 17:47631947-47631969 CAGGTATGAGTCACTGTGCTCGG - Intergenic
1148775567 17:50093697-50093719 CAGGTATGAGGCACTGTGCTAGG - Intergenic
1149313335 17:55417361-55417383 AAGGTAGGAGACGCGGAGCTGGG - Intronic
1149334530 17:55621821-55621843 CAGGTAAGAGATTGTGTGCAGGG + Intergenic
1149479701 17:56993060-56993082 TAGGTAGTAGATACTGTTCTAGG + Intronic
1149810591 17:59666477-59666499 CAGGTTGCAGATGCTATTCTAGG + Exonic
1149819757 17:59764599-59764621 CAGGCATGAGCTGCTGTGCCTGG + Intronic
1150111307 17:62502920-62502942 TATGTAGTAGATACTGTGCTAGG + Intronic
1150172980 17:63019493-63019515 CAGGTGTGAGATACTGTGCCTGG + Intronic
1150234755 17:63583938-63583960 TAGGTAGGATATACTTTGCTGGG - Intronic
1150260201 17:63783242-63783264 CAGGTGGTATATGATGTGCTAGG - Intronic
1150937585 17:69653711-69653733 CAGGCTGGAGATGATGGGCTAGG - Intergenic
1151293029 17:73164319-73164341 CATGTAGGAGAGACTGTGCTGGG + Intergenic
1151867571 17:76814353-76814375 CAGGTGTGAGCCGCTGTGCTGGG + Intergenic
1151942056 17:77298954-77298976 CAGGCATGAGCTGCTGTGCCTGG + Intronic
1151993776 17:77595924-77595946 AAGGAAGGAGAGTCTGTGCTTGG + Intergenic
1152442761 17:80319033-80319055 CAGGGAGGACATGCTTTGCGTGG + Intronic
1152486506 17:80597789-80597811 CAGGTGTGAGATGCTGTGCCTGG + Intronic
1152593579 17:81226586-81226608 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1152622622 17:81372869-81372891 CAGGGAGGAGGTGCTGGGTTGGG - Intergenic
1152793955 17:82297874-82297896 GAGGTGAGAGCTGCTGTGCTGGG + Intergenic
1153753666 18:8259224-8259246 TAGGCATGAGCTGCTGTGCTCGG + Intronic
1154206226 18:12339273-12339295 CAGGCATGAGCCGCTGTGCTTGG - Intronic
1155000191 18:21678230-21678252 CAGGTATGAGCTACTGTGCCTGG + Intronic
1155003025 18:21704764-21704786 CAGGCAGGAGACACTGTGGTCGG - Exonic
1155636136 18:27957527-27957549 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1155904968 18:31439543-31439565 CAGGTATGAGCTACTGTACTAGG - Intergenic
1156135851 18:34036644-34036666 CAGGCATGAGACACTGTGCTGGG - Intronic
1156265615 18:35485845-35485867 CAGGCATGAGTTCCTGTGCTTGG - Intronic
1156453381 18:37279227-37279249 CAGGCAGGTGCTGCTGGGCTGGG + Intronic
1156973175 18:43182629-43182651 CAGGTATGAGCCACTGTGCTTGG + Intergenic
1157636704 18:49163619-49163641 CAGGCAGGAGTTACTGTGCCTGG + Intronic
1157868408 18:51206734-51206756 CAGGCATGAGCTACTGTGCTTGG - Intronic
1158644658 18:59235061-59235083 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
1158760897 18:60385391-60385413 CAGATTGAAGAGGCTGTGCTTGG - Intergenic
1160617049 18:80138238-80138260 CAGGTCTGAGCTGCTGTCCTTGG - Exonic
1160687904 19:445454-445476 CAGGCATGAGCTGCTGTGCCAGG - Intronic
1161255280 19:3305369-3305391 GAGGTCGGAGATGCTGGGTTGGG + Intergenic
1161430409 19:4229228-4229250 CCAGCAGGACATGCTGTGCTGGG + Intergenic
1161940521 19:7400553-7400575 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1162124228 19:8490609-8490631 CAATGAGGAGATGCTGTGCCGGG - Exonic
1162164182 19:8740994-8741016 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162165254 19:8748463-8748485 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162166319 19:8755917-8755939 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162167385 19:8763373-8763395 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162168326 19:8769673-8769695 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162169392 19:8777126-8777148 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162170073 19:8782438-8782460 CAGGTGGGAGCTACTGTGCCCGG + Intergenic
1162449719 19:10747517-10747539 CAGGGAGGGGCTGCTGGGCTGGG + Intronic
1162657574 19:12142981-12143003 CAGGTACCAGCTGCTGTGCCTGG - Intronic
1163072688 19:14857590-14857612 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1163129250 19:15262109-15262131 CAGGTACGGGCTGCTATGCTGGG + Intronic
1163259393 19:16178796-16178818 CAGGTGTGAGCTGCTGTGCCCGG - Intergenic
1163326338 19:16605734-16605756 CAGGCGGGAGATGCTGGGCAAGG + Intronic
1163612533 19:18308817-18308839 CAGGCAGGACCAGCTGTGCTAGG + Intronic
1165665645 19:37625384-37625406 CAGGTGTGAGCTGCTGTCCTTGG - Intronic
1165721205 19:38081347-38081369 CAGGAAGCAGGTGCTGTCCTGGG - Exonic
1166287486 19:41840553-41840575 CAGGCGGGAGATACTGTGCCCGG - Intronic
1166516241 19:43449116-43449138 CAGGTGTGAGCTGCTGTGCCCGG - Intergenic
1166726883 19:45033875-45033897 CAGGTGTGAGCTGCTGTGCCAGG - Intronic
1166785114 19:45362926-45362948 CAGGGTGGGGATGCTGTACTGGG + Intronic
1167468754 19:49663971-49663993 CAGGCATGAGCTACTGTGCTCGG + Intronic
1168090336 19:54078778-54078800 CAGGTGTGAGACACTGTGCTCGG + Intronic
1168277289 19:55284913-55284935 CAGGGAGGAGGGGCTGTGCTTGG + Intronic
1168293575 19:55368749-55368771 CTGGTAGGAGAGACTGGGCTGGG - Exonic
1168342087 19:55630566-55630588 CAGGCATGAGCTGCTGTGCCCGG + Intergenic
925740480 2:7001397-7001419 CAGGCAGGAGACACTGTGCCTGG - Intronic
925744124 2:7030213-7030235 CAGGTAGGAGGTGATTTGCCTGG + Exonic
925805936 2:7647855-7647877 CAGGTGTGAGATGCTGTTCCTGG + Intergenic
926443796 2:12919877-12919899 CATGTGGGAGGTACTGTGCTTGG - Intergenic
926698850 2:15789216-15789238 CAGGGAGGTGGTGCTGTTCTGGG - Intergenic
928000802 2:27521616-27521638 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
928194429 2:29204864-29204886 CAGGCATGAGCTACTGTGCTTGG + Intronic
928256280 2:29725712-29725734 CATGTAGGACATGCTTTGCAGGG + Intronic
928580668 2:32704463-32704485 CAGGCATGAGCTGCTGTGCCCGG + Intronic
928649139 2:33386545-33386567 CAGGTGCGAGCTGCCGTGCTTGG - Intronic
929199451 2:39219696-39219718 CAGGTAGGAGCCACTGTTCTTGG + Intronic
929485635 2:42351681-42351703 CAGGCAGGAGAGGCTGGGCGCGG + Intronic
929586662 2:43120446-43120468 TAGGTGTGAGTTGCTGTGCTTGG - Intergenic
929984716 2:46716751-46716773 CAGGCATGAGCTACTGTGCTTGG + Intronic
930200354 2:48546841-48546863 CAGGTATGAGCTGCTGTGCCTGG + Intronic
930451013 2:51538411-51538433 CAGGCAAGAGCTGCTGTGCTCGG - Intergenic
930979355 2:57503926-57503948 CAGGTAGGAGAGCTTGTGCACGG + Intergenic
931234102 2:60398846-60398868 CAGGTGTGAGATGCTGCGCCCGG - Intergenic
931344700 2:61435024-61435046 TAGGTGTGAGGTGCTGTGCTTGG - Intronic
931374835 2:61697541-61697563 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
931401430 2:61934893-61934915 CAGGCATGAGCTGCTGTGCCTGG + Intronic
931507607 2:62948650-62948672 CAGTAAGGGGAGGCTGTGCTTGG - Exonic
932288722 2:70557362-70557384 CAGGGAGGAGAGGCTGTGATTGG - Intergenic
932828689 2:74966679-74966701 CAGGCGTGAGCTGCTGTGCTTGG + Intronic
933199579 2:79434014-79434036 CAGGTATGAGCTGCTGCGCCAGG - Intronic
934105243 2:88689339-88689361 CAGGTGAGAGCTGCTGTGCCTGG + Intergenic
934236188 2:90234853-90234875 GAGGAAGAAGAAGCTGTGCTGGG - Intergenic
935283940 2:101546824-101546846 CAGGCAGGAGGTGCTGTGCCTGG - Intergenic
935446313 2:103160179-103160201 TAGGTAGGAGAAACTTTGCTTGG - Intergenic
937166653 2:119824963-119824985 CAGGTATGAGCTACTGTGCCTGG + Intronic
937365869 2:121260812-121260834 CAGGCAGGAGGCCCTGTGCTGGG - Intronic
937403246 2:121604376-121604398 CAGGTAGGATAGGCTGGGCACGG + Intronic
937882062 2:126875791-126875813 CAGGTAGGGGATGATATGCTGGG + Intergenic
938231962 2:129669117-129669139 CAGGATGGTGATGCTGAGCTTGG - Intergenic
938893655 2:135729794-135729816 CAGGCATGAGCTGCTGTGCCCGG + Intergenic
939021199 2:136960414-136960436 CAGGTATGAGCCACTGTGCTTGG + Intronic
939668844 2:144983901-144983923 CAGGCATGAGCTGCCGTGCTTGG + Intergenic
940191286 2:151042588-151042610 CAGGTATGAGACGCTGTGCCTGG + Intronic
940930332 2:159421450-159421472 CAGGTATGAGCCACTGTGCTGGG + Intronic
941078425 2:161032804-161032826 CAGGTATGAGCCGCTGTGCCCGG - Intergenic
942855016 2:180535046-180535068 CATGTAGGAGAAGATGTGATGGG + Intergenic
943356308 2:186860226-186860248 CAGGCATGAGCTACTGTGCTAGG + Intergenic
943764750 2:191648558-191648580 CAGGTGTGAGCTACTGTGCTTGG + Intergenic
944219697 2:197290929-197290951 CAGGTGCGAGCTGCTGTGCCTGG - Intronic
944483551 2:200180800-200180822 CAGGGAGACTATGCTGTGCTTGG - Intergenic
944555413 2:200883480-200883502 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
944610040 2:201394025-201394047 CAGGCATGAGCTACTGTGCTTGG + Intronic
945083086 2:206105832-206105854 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
945284539 2:208069185-208069207 CAGGTGTGAGCTGCTGTGCCCGG + Intergenic
945568870 2:211439043-211439065 CATGTAGGAGATGCTGTGGTGGG + Intronic
946005527 2:216521347-216521369 CAGGTATGAGCTACTGTGCCTGG - Intronic
946230444 2:218287835-218287857 CAGGAGGGAGAGGCTGTCCTGGG + Intronic
946452424 2:219792169-219792191 CAGGCGTGAGCTGCTGTGCTTGG + Intergenic
947559109 2:231130737-231130759 CAGGCATGAGTTACTGTGCTTGG + Intronic
947785981 2:232820589-232820611 CAGGCATGAGCTGCTGTGCCCGG + Intronic
948110300 2:235449434-235449456 CAGGTATGAGCCACTGTGCTTGG + Intergenic
948193334 2:236076826-236076848 CAGGCATGAGACCCTGTGCTGGG - Intronic
948196856 2:236103106-236103128 CAGGGAGGAGGCGCTGTGCAGGG - Intronic
948459540 2:238122533-238122555 CAGGCCACAGATGCTGTGCTGGG + Intronic
948479757 2:238241778-238241800 CAGGTGAGTGATGCTGGGCTGGG - Intergenic
948510626 2:238461885-238461907 CGGGTGGGAGGTGCTGTACTGGG - Intergenic
948713020 2:239836906-239836928 CAGAGAGGAGATGCTGGGGTGGG - Intergenic
948846011 2:240683142-240683164 CAGGTAGGAGGAGCGGAGCTCGG - Intergenic
948847845 2:240691587-240691609 CAGGTAGGAGGAGCGGAGCTCGG + Intergenic
948914906 2:241029738-241029760 CAAGTAGGGGAGCCTGTGCTCGG - Intronic
1169610176 20:7370503-7370525 CAGTGAGGACATGCTGTGTTTGG - Intergenic
1170185936 20:13590588-13590610 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1170605581 20:17873213-17873235 CAGGCACGAGCTACTGTGCTTGG - Intergenic
1170705841 20:18744269-18744291 CAGGTAGGAGTTTCCCTGCTTGG + Exonic
1171049648 20:21843530-21843552 TAGGTAGCAGCTACTGTGCTAGG - Intergenic
1172251800 20:33484797-33484819 CAGGTATGAGCTGCCATGCTTGG + Intergenic
1172487476 20:35307021-35307043 CAGTTAGGTGATGCAGAGCTGGG + Intronic
1172571574 20:35974912-35974934 CAGGGAGGATACACTGTGCTTGG + Intronic
1172586802 20:36091403-36091425 CAGGAAGGAGAGGCAGGGCTTGG - Intergenic
1172600978 20:36182796-36182818 CATGTAAAAGCTGCTGTGCTGGG + Intronic
1172708127 20:36898303-36898325 CAGGTATGAGCTACTGTGCCAGG + Intronic
1172808193 20:37628267-37628289 CAGGTGTGAGATGCTGGACTTGG - Intergenic
1173627131 20:44481265-44481287 CAGGTATGAGCTGCTGCGCCTGG - Intronic
1173843955 20:46176563-46176585 CATGTACGAGGTACTGTGCTGGG + Intronic
1174005012 20:47403533-47403555 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1174115128 20:48221610-48221632 CAGGTATGAGCTACTGTGCCTGG - Intergenic
1174376595 20:50130145-50130167 GAGGGAGGAGATGCTATGATTGG - Intronic
1174391948 20:50223147-50223169 TTAGGAGGAGATGCTGTGCTCGG + Intergenic
1174826297 20:53771566-53771588 CAGGTGTGAGCTACTGTGCTCGG + Intergenic
1175084560 20:56447601-56447623 CAGGTAAGAGATGCTCAGCAAGG - Intronic
1175184366 20:57170032-57170054 CAGGTGGGAGCTACTGTGCCCGG + Exonic
1175395747 20:58660136-58660158 CAGCTAGGAGATGCAGAACTGGG - Intronic
1175565886 20:59976749-59976771 GACGTAGGGGCTGCTGTGCTAGG + Intronic
1175894397 20:62329638-62329660 AAGGCAGGAGCTGCTTTGCTGGG + Intronic
1176059087 20:63164362-63164384 CAGGAAGGAGATCCTGCCCTGGG - Intergenic
1176157979 20:63632309-63632331 CAGGTGGAAAATGCTGAGCTAGG + Intergenic
1176196566 20:63839223-63839245 CAGGTGTGAGCCGCTGTGCTCGG + Intergenic
1178414417 21:32392685-32392707 CAGAAAGGAGAGGCTGTGCCCGG + Intronic
1178468435 21:32870474-32870496 CAGGTGACAGATACTGTGCTAGG + Intergenic
1178808640 21:35860654-35860676 CAGGTAGGAGAGGCGAGGCTGGG + Intronic
1178997374 21:37415742-37415764 CAGGCATGAGCTGCTGTGCCTGG + Intronic
1179051079 21:37889055-37889077 AAGGTAGGAGATGCTGAGGGTGG + Intronic
1179175212 21:39003159-39003181 CAGGAAGGAGACGCCCTGCTGGG + Intergenic
1180108590 21:45636987-45637009 CAGGCTGGAGAAGCTGTGCCCGG - Intergenic
1180593513 22:16959597-16959619 CATGTGGGTGATGCTGTGCCAGG + Intergenic
1180866068 22:19120604-19120626 CAGGCAGGAGATGCTGGGCCTGG + Intronic
1182072894 22:27475973-27475995 CAGGTGTGAGCTGCTGTGCCGGG - Intergenic
1182092141 22:27603009-27603031 CAGGTGGGTGATGGTGAGCTCGG + Intergenic
1182281384 22:29219500-29219522 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1182596465 22:31424772-31424794 CAGGTATGAGCTGCTGTGCCCGG + Intronic
1182660043 22:31918780-31918802 AAGGTGGCAGGTGCTGTGCTAGG - Intergenic
1182713204 22:32335327-32335349 GAAGGAGGAGATACTGTGCTAGG - Intergenic
1182851615 22:33479301-33479323 CAGGTGCCAGATGCTGTGCTAGG - Intronic
1183177467 22:36234862-36234884 CACGTAGTAGATTCTGAGCTTGG - Intronic
1183540581 22:38427209-38427231 CAGGTAGGAGCTGCGGGCCTGGG + Exonic
1183552435 22:38498138-38498160 CAGGCAGGAGATACTGTGGAGGG + Exonic
1183667962 22:39256121-39256143 CACGTCTGAGATGCTGTCCTCGG + Intergenic
1183849599 22:40573623-40573645 CAGGTATGGGATTCTGTGCCTGG - Intronic
1184196414 22:42932158-42932180 CAGAGAGAAGATCCTGTGCTGGG - Intronic
1184241479 22:43213242-43213264 CTGGTAGGAGATTCCGTGTTTGG - Intronic
1184279514 22:43428976-43428998 CAGAGAGGAGTTGCTGTGCCTGG - Intronic
1184969270 22:48003523-48003545 CAAGGAGCAGATGCTGTGCTTGG + Intergenic
1185047367 22:48535111-48535133 CAGGTAAGGGTTGCTGGGCTGGG - Intronic
1185161550 22:49232911-49232933 CTGGGTGTAGATGCTGTGCTGGG + Intergenic
949351767 3:3130757-3130779 CAGGTGGGAGACACTGTGCCCGG - Intronic
950013914 3:9743086-9743108 CCGGTAGAAGATGGTGTCCTTGG - Exonic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
950578319 3:13846420-13846442 CAGCTGGCAGGTGCTGTGCTGGG - Intronic
950660205 3:14462418-14462440 CAGGTGTGAGCTACTGTGCTGGG - Intronic
950751237 3:15129714-15129736 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
951779360 3:26345974-26345996 CACGTAGGACAGGCTCTGCTGGG + Intergenic
952244586 3:31572876-31572898 GAAGTACCAGATGCTGTGCTTGG + Intronic
952354005 3:32567978-32568000 CAGGCAGGAGCTGCCGTGCCAGG + Intronic
952410259 3:33042655-33042677 GAAGTAGGAGAGGCTGTGCGCGG - Intronic
952411772 3:33055742-33055764 CAGGTAGGAGGCACTGCGCTGGG + Intronic
953430212 3:42833139-42833161 CAGGCATGAGCTACTGTGCTTGG + Intronic
953546882 3:43870073-43870095 CAGATATGAAATGCTGAGCTGGG + Intergenic
954056922 3:48034423-48034445 CAGGTATGAGCCACTGTGCTGGG - Intronic
954131919 3:48565205-48565227 CAGGTAGGGCAGGGTGTGCTGGG + Intronic
954700321 3:52447503-52447525 CTGGTGGGAGATGGTGAGCTGGG + Intergenic
955293442 3:57713903-57713925 CAGGTATGAGCTACTGTGCCTGG - Intergenic
955782295 3:62497877-62497899 CAGGTAGGAGGCGTTGTGTTGGG + Intronic
956428509 3:69161152-69161174 CAGGTGTGAGCTACTGTGCTGGG + Intergenic
956990431 3:74756796-74756818 CAGGCAGGAGGAGGTGTGCTGGG + Intergenic
957516604 3:81262278-81262300 CAAACAGAAGATGCTGTGCTGGG - Intergenic
958440793 3:94153894-94153916 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
958530814 3:95328606-95328628 CTGGTTGTAGTTGCTGTGCTTGG + Intergenic
959985963 3:112571693-112571715 CAGGCAGGAGAGCTTGTGCTGGG + Intronic
960719096 3:120607989-120608011 CAGGCATGAGCTGCTGTGCCCGG + Intergenic
960825314 3:121776685-121776707 CAGGTATGAGCCACTGTGCTGGG + Intronic
961283877 3:125784461-125784483 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
961675312 3:128561365-128561387 CAGGCATGAGCTGCTGTGCCCGG - Intergenic
962221793 3:133570679-133570701 CAAGTAGGAGCCGCTGTGCCCGG - Intergenic
962556412 3:136556858-136556880 CAGGTACGAGCCACTGTGCTTGG + Intronic
962578532 3:136776398-136776420 CAGGTGTGAGACACTGTGCTTGG - Intergenic
962598466 3:136970927-136970949 CAGGCATGAGACGCTGTGCCTGG + Intronic
963805434 3:149716897-149716919 GAGGTATGAGCTGCTATGCTTGG - Intronic
963878200 3:150500454-150500476 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
964726882 3:159822808-159822830 CAGGTAGGAGATTCAGAGCAGGG + Intronic
964792743 3:160468531-160468553 CAGGCATGAGCTACTGTGCTCGG - Intronic
964874354 3:161349172-161349194 CAGGCAGGAGATGCTCTTCCAGG + Intronic
965557110 3:170029942-170029964 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
965699324 3:171443554-171443576 CAGGTAGGAGCCAGTGTGCTGGG - Intronic
965928146 3:174008460-174008482 CAGGGAGGAAATGGTGGGCTGGG - Intronic
966079101 3:175977962-175977984 CATCAAGGAGAAGCTGTGCTAGG - Intergenic
966399626 3:179535112-179535134 CAGGTGTGAGCTACTGTGCTCGG - Intergenic
966443529 3:179974605-179974627 AAGATAGGAGATACTGTGTTTGG - Intronic
967595129 3:191318746-191318768 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
967871548 3:194234016-194234038 GAGGCAGGAATTGCTGTGCTAGG + Intergenic
968760198 4:2438906-2438928 CAGGGAGGAGAGGCTGTTCTGGG - Intronic
969013830 4:4089740-4089762 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
969031415 4:4218112-4218134 CAGGTATGAGCCACTGTGCTTGG - Intronic
969659039 4:8515653-8515675 CAGGGAGCAGAGGCTGGGCTAGG + Intergenic
969740157 4:9018689-9018711 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
969799323 4:9550204-9550226 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
969834492 4:9829124-9829146 CAGGTGTGAGCTACTGTGCTCGG - Intronic
970889187 4:21023624-21023646 CAGGTATGAGCCACTGTGCTTGG - Intronic
971295339 4:25384548-25384570 CAGGCATGAGCTGCTGTGCCTGG - Intronic
971323572 4:25625513-25625535 CAGGCATGAGACACTGTGCTTGG - Intergenic
972380134 4:38511772-38511794 CAGAAAGAAGATGCTGTGCGTGG - Intergenic
972574583 4:40339942-40339964 CAGGCATGAGCTGCTGTGCCCGG + Intronic
973190721 4:47382171-47382193 TAGCTATGAGATGCTGTGTTTGG - Intronic
973322707 4:48826113-48826135 CAGGCATGAGCTACTGTGCTTGG + Intronic
973746204 4:53965689-53965711 CAAGTAGGAGATGCTCAGGTGGG + Intronic
974341273 4:60617333-60617355 AAGGTAGGAGATGCTGTTTCAGG + Intergenic
974902576 4:68019431-68019453 CAGGTAAGAGATTCTAAGCTTGG + Intergenic
975223800 4:71845788-71845810 CAGGTATGTGTTGCTGTGCCTGG + Intergenic
975393928 4:73853401-73853423 CCGCCAGGAGATGCTGTTCTTGG + Exonic
975606181 4:76156538-76156560 CAATTAGGAGCTGTTGTGCTAGG - Intergenic
976928037 4:90526546-90526568 CAGGTGGGGGATGGTGGGCTAGG - Intronic
978232573 4:106418642-106418664 CTGGCAGGAGATGCTGTTATAGG + Intergenic
978850208 4:113326722-113326744 CAGGTATGAGCTACTGTGCCTGG - Intronic
980437604 4:132798990-132799012 CAGGTAAGAGATGCTCTGCCAGG - Intergenic
981087493 4:140699040-140699062 TTGGTAGGAAGTGCTGTGCTGGG - Intronic
982048653 4:151476135-151476157 CAGGCATGAGACACTGTGCTCGG + Intronic
982606323 4:157520987-157521009 CAAGTAGGAAATACTTTGCTTGG + Intergenic
983676123 4:170295398-170295420 AAGGTAGCATATGCTGTGCTTGG + Intergenic
983766224 4:171488429-171488451 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
984706342 4:182849813-182849835 CAGGTATGAGCCACTGTGCTCGG + Intergenic
985671101 5:1207072-1207094 CAGGTAGGAGACGCACTGCGCGG + Intronic
985741763 5:1621578-1621600 CGGGTAGGAGCTGCGGTTCTAGG - Intergenic
986051821 5:4097234-4097256 CAGGTGTGAGATGCTGCACTCGG + Intergenic
986283032 5:6339081-6339103 CAGGTAGCAAATGCTGTGTGAGG - Intergenic
987338881 5:16921935-16921957 CAGGTGGGAGCTGCTGTGCCCGG - Intronic
988098279 5:26645596-26645618 CAGGTATGAGCTACTGTGCCCGG + Intergenic
988571404 5:32370652-32370674 CAGGTAGGAGCCATTGTGCTAGG + Intronic
989037518 5:37191253-37191275 CAGGTGTGAGCTACTGTGCTTGG - Intronic
989354043 5:40521180-40521202 CAGATAGGAGGTGTTGGGCTCGG + Intergenic
990563754 5:57008662-57008684 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
991178783 5:63724071-63724093 CAGGTAGGTGCTGATATGCTAGG + Intergenic
991226465 5:64278895-64278917 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
992596281 5:78350740-78350762 CAGGTATGAGACACTGTGCCTGG - Intergenic
992679872 5:79143155-79143177 CAGGCATGAGCTGCTGTGCCTGG - Intronic
993996139 5:94725439-94725461 CAGATAGCAAATGCTGGGCTAGG + Intronic
994087764 5:95779064-95779086 GAGACAGGAGATGTTGTGCTTGG + Intronic
996455283 5:123674529-123674551 CAGGTATGAGCTACTGTGCCCGG + Intergenic
996985459 5:129557318-129557340 CAGGCAGGAGCCACTGTGCTTGG - Intronic
997332858 5:133079009-133079031 CAGGCACGAGATACTGTGCCTGG + Intronic
997436968 5:133882557-133882579 CAGGAAGGAGAGGCAGAGCTGGG - Intergenic
997496119 5:134327648-134327670 CAGTTAGGAGATGCTTTCCTGGG + Intronic
997905906 5:137816836-137816858 CAGGTGTGAGCCGCTGTGCTCGG + Intergenic
999073864 5:148776658-148776680 CAGGTGTGAGATGCTGCGCCTGG + Intergenic
999762966 5:154716780-154716802 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
999865321 5:155694760-155694782 CAGTTATGAGCTGCTGTGCCTGG - Intergenic
999890186 5:155969758-155969780 TGGGTAGGAGGTGCTGTGCTAGG - Intronic
1000240305 5:159402750-159402772 CAGTGAGCAGGTGCTGTGCTAGG + Intergenic
1001823315 5:174726199-174726221 CAGGTAGGGGATGGCGTGGTGGG - Intronic
1002021136 5:176365307-176365329 GAGGAAGGAGAGGCTGTGCCTGG - Intergenic
1002170389 5:177371244-177371266 CAGGTAGGGGACGCTGGCCTCGG + Exonic
1002200020 5:177522615-177522637 CAGGTGGGAGACACTGTGCTTGG + Intronic
1003132104 6:3403530-3403552 CTGGGAAGAGATGCTGTGATAGG - Intronic
1003676864 6:8212629-8212651 CAGGTATGAGGCACTGTGCTGGG + Intergenic
1004056802 6:12147152-12147174 CAGGTAATAGATGCTGTGCAGGG + Intronic
1004375076 6:15084019-15084041 CAGGCAGGAGCCACTGTGCTTGG - Intergenic
1006147800 6:31969620-31969642 CTGGTAGGAGAGCCTGTGCTGGG + Exonic
1006552218 6:34833957-34833979 CAGGTATGAGCCACTGTGCTTGG - Intronic
1006950095 6:37814739-37814761 CAGGCTGGAGATGGTATGCTTGG + Intergenic
1008616096 6:53227949-53227971 CAGGTATGAGCCACTGTGCTTGG - Intergenic
1010143219 6:72635305-72635327 TAGGAATGAGCTGCTGTGCTTGG + Intronic
1010632095 6:78209822-78209844 CAGATATGAGCTGCTGTGCCTGG + Intergenic
1010847246 6:80724191-80724213 CAGGCATGAGCTGCTGTGCTTGG - Intergenic
1011086473 6:83546675-83546697 CAGGTGGGACCTGCTGAGCTAGG - Intergenic
1011313963 6:86010887-86010909 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1012224467 6:96688577-96688599 CAGGTAATAGATCCTGTGTTGGG - Intergenic
1012678737 6:102152378-102152400 CAGATGGGAGCTGCTGTGCCTGG - Intergenic
1012885573 6:104842326-104842348 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1012947835 6:105486836-105486858 GAGGGAGGAGATGGGGTGCTGGG - Intergenic
1014550545 6:122785389-122785411 CAGGTGTGAGCTGCTGTGCCTGG - Intergenic
1015549426 6:134396707-134396729 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1015985052 6:138876188-138876210 CAGGGAAGTGATGCTGGGCTGGG - Intronic
1016639834 6:146335956-146335978 CAGGCAGGAGATCATGTGCAGGG - Intronic
1017468728 6:154719206-154719228 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1017483592 6:154882186-154882208 TACATAGCAGATGCTGTGCTGGG - Intronic
1017750434 6:157486330-157486352 CAGGTAGGAGATGCTGTGCTTGG - Intronic
1018086432 6:160304929-160304951 CAGGCAAGAGATGATGTGCAGGG + Intergenic
1018828772 6:167425925-167425947 CTGGGAGGAGAAGCTGTGCCAGG - Intergenic
1018845417 6:167552058-167552080 CAGGAAGCAGGTGCTGTGGTGGG + Intergenic
1019258065 7:64287-64309 CAGGTGGGAGCTGCAGTGCAGGG + Intergenic
1019341563 7:511121-511143 CAGGCAGCAGAGGCTGAGCTGGG + Intronic
1019593806 7:1849179-1849201 CAGGGAGCTGATGCTGTGCGAGG + Exonic
1019783390 7:2958173-2958195 CAGGCAGGAGACACTGTGCCTGG - Intronic
1020109800 7:5441710-5441732 GAGGAAGGAGAGGCTGGGCTGGG - Intronic
1020285699 7:6678457-6678479 CAGGCATGAGCTACTGTGCTTGG + Intergenic
1021000789 7:15328051-15328073 CAGGTATGAGACACTGTGCCTGG + Intronic
1021725103 7:23540913-23540935 CAGGCATGAGCTGTTGTGCTCGG + Intergenic
1023107571 7:36777440-36777462 CAGGTATGTGATGCTGAGCTCGG - Intergenic
1023441876 7:40192908-40192930 CAGGTATGAGCTACTGTGCCTGG + Intronic
1024049864 7:45611787-45611809 CAGGTAGGAGATGGTGTTTGAGG + Intronic
1024059203 7:45685699-45685721 CAGGTTGGAGCCGCTGGGCTGGG + Intronic
1024224230 7:47313567-47313589 CAGGTACTGCATGCTGTGCTGGG - Intronic
1024470776 7:49767224-49767246 TATGTAGGGGATGCTTTGCTTGG - Intergenic
1024766545 7:52667696-52667718 CAGGTTGCATATGCTGTGTTTGG + Intergenic
1024974295 7:55099274-55099296 TATGTAACAGATGCTGTGCTGGG + Intronic
1025175837 7:56802037-56802059 GAGGCAGGAGAAGCTGAGCTTGG + Intergenic
1025695956 7:63774385-63774407 GAGGCAGGAGAAGCTGAGCTTGG - Intergenic
1026112481 7:67469406-67469428 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1026403377 7:70039144-70039166 CAGGCAGGAGTCACTGTGCTGGG - Intronic
1026553003 7:71383709-71383731 CAGGTGTGAGTTGCTATGCTTGG + Intronic
1026675913 7:72427756-72427778 CAGGTAGGAGCCACGGTGCTGGG + Intronic
1026934390 7:74244688-74244710 CAGGCATGAGGTGCTGTGCCTGG - Intronic
1027159274 7:75790540-75790562 CAGGCAGGAGCTGCTGTGCCTGG + Intergenic
1028405216 7:90466923-90466945 CAGGTATGAGCTACTGTGCCTGG - Intronic
1028903342 7:96125367-96125389 CAGGCATGAGCTACTGTGCTGGG + Intronic
1029072482 7:97911359-97911381 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1029341334 7:99947190-99947212 CAGGCAGGAGCCACTGTGCTTGG - Intergenic
1029371215 7:100151979-100152001 CAGGCATGAGCTCCTGTGCTTGG + Intronic
1030222081 7:107107931-107107953 CAGGCGTGAGATGCTGTGCCCGG + Intronic
1030929369 7:115503410-115503432 CAGGTATGAGCCACTGTGCTTGG - Intergenic
1031988311 7:128178338-128178360 CTGGGAGGAAATGCTGGGCTGGG + Intergenic
1032001073 7:128265665-128265687 CAAGTGGGAGATGGTGTGATTGG - Intergenic
1032040508 7:128556833-128556855 TATGTAGTAGATACTGTGCTAGG + Intergenic
1032814144 7:135454374-135454396 CAGGAATGAGTTGCTGTGCCCGG - Intronic
1033304760 7:140216817-140216839 CAGGCATGAGACACTGTGCTTGG - Intergenic
1033327619 7:140392515-140392537 CAGGTAGGAGATGCTGCTGGTGG - Intronic
1033345491 7:140522883-140522905 CAGGTGTGAGCTGCTGTGCCTGG + Intronic
1034075054 7:148223359-148223381 TAGGCAGGAGATGTAGTGCTGGG - Intronic
1034450345 7:151133978-151134000 CAGGTGGGGGCTGCAGTGCTTGG + Intronic
1034986936 7:155522130-155522152 CAGGTAGAAGATGCAGCGCCTGG - Intronic
1035277832 7:157758549-157758571 CAGGTGGCAGCTGCTGTGCTGGG + Intronic
1035441788 7:158907888-158907910 CAGGTGTGAGCTGCTGTGCCCGG + Intronic
1036255569 8:7203865-7203887 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1036361917 8:8083636-8083658 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1036401828 8:8415667-8415689 CAGGCAGGTGAGGCAGTGCTTGG + Intergenic
1036889051 8:12583384-12583406 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1036896634 8:12641528-12641550 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1037008322 8:13808948-13808970 CAGGTATGAGCCGCTGTGCCCGG + Intergenic
1038051964 8:23822312-23822334 CAGGCAGGAGCTGCTGTGCCTGG + Intergenic
1038193066 8:25341647-25341669 CAGGAAGAAAAGGCTGTGCTTGG - Intronic
1038505969 8:28085356-28085378 CAGGTATGAGCTACTGTGCTGGG + Intergenic
1038584522 8:28777132-28777154 GAGGTTGAAGGTGCTGTGCTGGG + Intronic
1039528232 8:38235348-38235370 CAGGTGTGAGCTACTGTGCTTGG + Intronic
1039717892 8:40130518-40130540 CAGGCATGAGTTACTGTGCTTGG + Intergenic
1040131130 8:43797938-43797960 CAGGTTGGAAATGCTGTTTTTGG + Intergenic
1040598110 8:48859637-48859659 CAGGTAGAGGAAGCTGTGCCTGG - Intergenic
1040931652 8:52741528-52741550 CAGGTGTGAGTTGCTGTGCCCGG - Intronic
1040944299 8:52866986-52867008 CAGGTATGAGCTGCAGTGCCTGG - Intergenic
1041040085 8:53838028-53838050 CTGGGAGGACATGCAGTGCTTGG - Intronic
1041674970 8:60528851-60528873 CAGGTGTGAGTTACTGTGCTTGG + Intronic
1042224663 8:66505722-66505744 TAGGTAGAAGATGCTGTGTGAGG - Intronic
1042527775 8:69782302-69782324 CAGGTGTGAGCCGCTGTGCTAGG - Intronic
1043440040 8:80269010-80269032 CAGGTTTGAGCTGCTGTGCCTGG - Intergenic
1044261626 8:90131455-90131477 CAGGTAGTAGATCCTGTGGGAGG + Intergenic
1044426801 8:92061697-92061719 CAGGCAGAAGAGGCTGTGCTTGG - Intronic
1044872588 8:96633930-96633952 CAGGCATGAGCTACTGTGCTTGG + Intergenic
1045811071 8:106220706-106220728 CAAGTGGGAGATACTGTGTTGGG + Intergenic
1046058087 8:109102451-109102473 CATGTACCAGATACTGTGCTAGG - Intronic
1046176287 8:110579251-110579273 CATATATGACATGCTGTGCTAGG + Intergenic
1047468118 8:125139564-125139586 CAGGTAAGAGAACCTGTGCAGGG + Intronic
1048868018 8:138775125-138775147 CATGTCTGAGATGCTTTGCTGGG - Intronic
1048931624 8:139319838-139319860 CAGGTGGGAGAGGCTGCACTAGG + Intergenic
1050104400 9:2150483-2150505 CAGGCAGCAGATGCTGTGGGTGG + Intronic
1050154639 9:2653050-2653072 CAGGTAGCAGATGAAGTGTTTGG - Intronic
1053499503 9:38573437-38573459 CAGGCATGAGCTGCTGTGCCCGG - Intronic
1054731909 9:68709508-68709530 CAGGTGTGAGACCCTGTGCTCGG + Intronic
1056172250 9:83997386-83997408 CAGGTACGAGCTACTGTGCCTGG + Intronic
1056214984 9:84398166-84398188 CAGGAAGCAGATGCTGTGCCCGG + Intergenic
1056235334 9:84588414-84588436 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1057253775 9:93526244-93526266 CAGGTAGCAGAGGATGTGCAGGG - Intronic
1057336259 9:94157546-94157568 CTAGTGGGAGATGCTGAGCTTGG + Intergenic
1057602444 9:96470625-96470647 CAGTTACGAGCTGCTGTGCCTGG - Intronic
1057886862 9:98836395-98836417 TAAGTACCAGATGCTGTGCTTGG + Intronic
1058393438 9:104522916-104522938 CAGCAAGGATATGCTGTGCTTGG + Intergenic
1058782684 9:108354045-108354067 CTGGTGGGAGATGCTGTGCTTGG + Intergenic
1058898633 9:109421798-109421820 GACAGAGGAGATGCTGTGCTGGG - Intronic
1058931146 9:109720264-109720286 CAGGCATGAGCTGCTGTGCCTGG + Intronic
1059183679 9:112245029-112245051 CAGGTATGAGCTACTGTGCCCGG - Intronic
1059816579 9:117923373-117923395 CAGGTATGAGCTACTGTGCCCGG + Intergenic
1060589626 9:124808631-124808653 CAGGAAGGTGATGCTGAGCTGGG + Intronic
1061120278 9:128637718-128637740 CAGGCATGAGCTGCTGTGCCTGG + Intronic
1061252469 9:129434636-129434658 CAGCTGGGAGATGCTGGGGTGGG - Intergenic
1061460617 9:130735305-130735327 CAGGTATGAGCCACTGTGCTAGG + Intronic
1061716264 9:132520366-132520388 CAGGTGTGAGCTGCTGTGCCTGG - Intronic
1061730831 9:132612541-132612563 CTGGTACCAGGTGCTGTGCTGGG - Intronic
1062119259 9:134825257-134825279 CCGGCAGCAGACGCTGTGCTTGG + Intronic
1062415881 9:136449567-136449589 CAGGCAGGAGCTGCTGCGCCCGG + Intronic
1185649063 X:1635582-1635604 CAGGCATGAGCTGCTGTGCCCGG - Intronic
1185981561 X:4785507-4785529 CAGGTATGAGCTACTGTGCCTGG - Intergenic
1186261782 X:7787867-7787889 CAAGCAGGAAATGCTGTGCAGGG + Intergenic
1186461707 X:9753511-9753533 AAGGGAGGAGGAGCTGTGCTTGG + Intronic
1187142883 X:16611171-16611193 CAGGCATGAGTTACTGTGCTTGG - Intronic
1187287307 X:17917782-17917804 CAGGCATGAGCTGCTGTGCAGGG + Intergenic
1187290742 X:17951002-17951024 CAGGTAAGAGAGCCTGTGCAGGG + Intergenic
1187862708 X:23697392-23697414 CAGGTATGAGCTACTGTGCCTGG + Intergenic
1189742553 X:44135077-44135099 CAGGTATGAGACACTGTGCCTGG + Intergenic
1190118707 X:47642881-47642903 CAGGTGTGAGATACCGTGCTCGG + Intronic
1190466957 X:50734690-50734712 CAGGCATGAGCTGCTGTGCCCGG + Intronic
1190870140 X:54417920-54417942 CAGGCATGAGCTGCTGTGCTTGG + Intergenic
1191000193 X:55651863-55651885 CAGGTGGGAGCCACTGTGCTGGG - Intergenic
1192782688 X:74309984-74310006 CAGGCATGAGCTGCTGTGCCCGG - Intergenic
1193163100 X:78251004-78251026 CAGGCATGAGTTACTGTGCTTGG + Intergenic
1193943764 X:87707766-87707788 TAGGTAGGAGAGTCTGTCCTTGG + Intergenic
1194850179 X:98859724-98859746 CAGGCAGGAGAGCCTGTGCAGGG - Intergenic
1195353965 X:104020786-104020808 CAGGTGTGAGCTGCTGTGCCTGG + Intergenic
1196823630 X:119723689-119723711 CAGGTATGAGCCGCTGTGCCTGG + Intergenic
1197049009 X:122035765-122035787 CAGGTGTGAGACGCTGCGCTGGG + Intergenic
1198097710 X:133397145-133397167 CAGGTGTGAGCTGCTGTGCCCGG - Intronic
1199941979 X:152636638-152636660 CAGGTAAGTCATGCTTTGCTGGG + Intergenic
1199974707 X:152886472-152886494 CAGGCAGGTGCTGCTGTACTTGG - Intergenic
1200224376 X:154409167-154409189 CAGGCAGGAGCTGCTCTTCTGGG - Exonic
1201074920 Y:10179632-10179654 CAGGTGGGAGACACTGTGCCCGG - Intergenic
1202343025 Y:23889158-23889180 CAGGCATGAGCTACTGTGCTTGG - Intergenic
1202364722 Y:24150630-24150652 CAGGCATGAGCTGCTGTGCCTGG + Intergenic
1202506059 Y:25519492-25519514 CAGGCATGAGCTGCTGTGCCTGG - Intergenic
1202527743 Y:25780927-25780949 CAGGCATGAGCTACTGTGCTTGG + Intergenic
1202575707 Y:26322380-26322402 CAGGTGTGAGCTGCTGTGCCCGG + Intergenic