ID: 1017750520

View in Genome Browser
Species Human (GRCh38)
Location 6:157486959-157486981
Sequence CACCTACCAATGCTGTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017750520 Original CRISPR CACCTACCAATGCTGTAGCT GGG (reversed) Intronic
901393113 1:8960367-8960389 CAACTATCAATGCTGTGGCTGGG + Intronic
904824263 1:33264390-33264412 CAGCTGCCATTGCTGTTGCTAGG - Intronic
905304453 1:37007860-37007882 CACCTCCCACTGCTGCTGCTCGG - Intronic
906087064 1:43144989-43145011 CACTTACCAAGGCTGAAGGTGGG - Intergenic
906153047 1:43598909-43598931 CACCACCCAATGCTGCACCTGGG - Exonic
909285529 1:73811867-73811889 CACCTATCAATGCATTACCTAGG - Intergenic
912698179 1:111856724-111856746 CACCTAGCAATGCAGTCACTTGG - Intronic
914727330 1:150338813-150338835 CACTTACAAATGCAGGAGCTTGG - Intronic
915763239 1:158336528-158336550 CACCTGCCATTGCTGAGGCTTGG + Intergenic
917363226 1:174200141-174200163 AATGTACCAATGCTGTAGCAAGG + Intronic
917731771 1:177881732-177881754 GACTTACTAATGCTGTAACTTGG + Intergenic
917960182 1:180136563-180136585 TAGCTACAAATGCTGTATCTTGG - Intergenic
924682426 1:246251390-246251412 CACCTACTAAAGCTGTAGGCTGG - Intronic
1063216113 10:3927084-3927106 CACCTGGCAAAGCTGCAGCTGGG + Intergenic
1064428848 10:15254266-15254288 CACCCACCTATGCTGCAGCCAGG - Intronic
1069296671 10:66854272-66854294 CACCTAACAAATCTGTACCTGGG - Intronic
1069546520 10:69333244-69333266 CAAATCCCAATGCTGTGGCTTGG - Intronic
1070810509 10:79295372-79295394 GACCACCCAGTGCTGTAGCTGGG - Intronic
1088364191 11:109021535-109021557 CACCTCCTAATGCTATAACTTGG + Intergenic
1090104702 11:123840235-123840257 CACTTACCAATGATGTAGTTTGG + Intergenic
1090540878 11:127702500-127702522 AACCTACCAATGGTATTGCTAGG + Intergenic
1095673715 12:44891456-44891478 AAACTACCACTGCTGGAGCTCGG + Intronic
1099059122 12:77884023-77884045 CACCTATCAAAGCTATAGTTGGG - Intronic
1101598285 12:106186863-106186885 CACATATCATTGCTGTAGCTCGG + Intergenic
1102923602 12:116810601-116810623 CACATACCCATGATGTAGTTTGG - Intronic
1104494779 12:129226659-129226681 CACCTACCAATATTGTTTCTTGG - Intronic
1106050116 13:26181608-26181630 TACCTACCAATGGTATAGCTTGG - Intronic
1108406695 13:50110696-50110718 TGGCCACCAATGCTGTAGCTTGG - Intronic
1110081731 13:71322050-71322072 ATCTTACAAATGCTGTAGCTTGG + Intergenic
1110157023 13:72329822-72329844 AACCTACCAGTGCTTGAGCTTGG - Intergenic
1115907284 14:38214004-38214026 CTCCTTCCAATGCATTAGCTGGG + Intergenic
1117226028 14:53659872-53659894 CAACTAGCAATGTTGTAGATAGG - Intergenic
1120178053 14:81316190-81316212 CACCTGCCATTTCTGTTGCTTGG - Intronic
1121108775 14:91297803-91297825 CAGATACCAAAGCTGTAGCATGG - Intronic
1122882210 14:104695245-104695267 CACCTACCATGGCTGTGGCTGGG - Intronic
1129384468 15:75188336-75188358 CAGCTCCCAGTGCTGTGGCTGGG - Intergenic
1131406422 15:92168629-92168651 CACCTAAGACTGCTGTAGCATGG + Intronic
1133744675 16:8676986-8677008 CAACAACCAATCCTTTAGCTGGG - Intronic
1147385556 17:40079356-40079378 CAGCTACCAATGCTGAAGCAGGG - Intronic
1150656388 17:67042489-67042511 CACCCAGCAAAGCAGTAGCTGGG - Intergenic
1155717913 18:28969897-28969919 CACCTACCCATGATCTAGGTTGG + Intergenic
1156258737 18:35424548-35424570 CCTCTTCCAATGCTGTAGCCTGG + Intergenic
1157193411 18:45600086-45600108 CACCCATAAATCCTGTAGCTGGG - Intronic
1165306408 19:35005438-35005460 CACCGACCAAGGCGGGAGCTGGG + Intronic
933906028 2:86893360-86893382 CACCTACCATAACTGGAGCTGGG - Intergenic
935588800 2:104826081-104826103 CACCACCCAGAGCTGTAGCTGGG + Intergenic
945541119 2:211087991-211088013 CACCTTCCAATTCCTTAGCTTGG + Intergenic
1169584700 20:7068119-7068141 CACCTCACAATGCTGTATTTAGG + Intergenic
1170296150 20:14828515-14828537 CTCCTACCACTGCTGTCTCTTGG - Intronic
1170681917 20:18533548-18533570 CTCCTAACAATGCTGTAGAGTGG - Intronic
1174584801 20:51600093-51600115 CAGATCCCAACGCTGTAGCTTGG + Exonic
1175274243 20:57756713-57756735 CCCCTGCCACTGCTGTAACTGGG - Intergenic
1184059608 22:42074099-42074121 CACCGACCAGTGCTGTGGCTCGG + Intergenic
952017333 3:28973297-28973319 TACCAACCACTGCTGTAGGTAGG - Intergenic
952946148 3:38478970-38478992 CCCTTACAAATGCTGAAGCTGGG + Intronic
957877225 3:86163354-86163376 GACCTACTACTCCTGTAGCTTGG + Intergenic
965693854 3:171386044-171386066 CTCCTTCCAAAGCTGAAGCTGGG + Intronic
966207476 3:177419929-177419951 CACCTCCCACGGCAGTAGCTTGG + Intergenic
970643250 4:18090677-18090699 CACCTGCCATTGCTGAGGCTCGG + Intergenic
971296014 4:25392745-25392767 TACCTCCCAATTCTGTAGGTTGG + Intronic
973263979 4:48192845-48192867 CTCCTACCAAGGCTGCTGCTTGG + Intronic
973612554 4:52650046-52650068 CACCTAGCAAAGCTGCAGATGGG + Intronic
974614468 4:64264484-64264506 GAACTACCAATGCTGTAGCTTGG - Intergenic
976318091 4:83681002-83681024 CAATTACAAATGCTGTAGCAAGG + Intergenic
977343681 4:95791824-95791846 CACCCACCAATGCTGAGGCTTGG + Intergenic
982823562 4:159974679-159974701 CACCCACGAATGCTATAGCAGGG - Intergenic
983677532 4:170313261-170313283 TACCTAACAAGGCTGTATCTGGG + Intergenic
984632996 4:182080014-182080036 CATCTAACAATTCTGTAACTGGG - Intergenic
986766600 5:10933566-10933588 CACAGACCAATGCTCTAGGTTGG + Intergenic
988973349 5:36491304-36491326 CTCCTACCCTTGGTGTAGCTGGG + Intergenic
989084309 5:37658690-37658712 CACCTAGCACTTCTGAAGCTGGG - Intronic
990335796 5:54771392-54771414 CAGCTCCCAATCCTGAAGCTCGG + Intergenic
991266376 5:64723981-64724003 CACCTTCCAATGATGAAGCAAGG - Exonic
993254450 5:85571529-85571551 CACATACCAGTGTTGTAGCCAGG + Intergenic
995797125 5:115953378-115953400 CACTGGCCAATGATGTAGCTTGG - Intergenic
998388818 5:141773944-141773966 GCCCTCCCAAAGCTGTAGCTTGG - Intergenic
1002848570 6:970492-970514 TACCTCCCAATGTTGTTGCTGGG + Intergenic
1003957672 6:11179254-11179276 CACCTCCAAATGCTGTTGCAAGG - Intergenic
1010185138 6:73135091-73135113 CACCTACCAATTCTATTTCTAGG + Intronic
1011296800 6:85835053-85835075 CACCCACCATTGCTGAGGCTTGG - Intergenic
1015771879 6:136776664-136776686 CACCGACAAATTCTTTAGCTTGG + Intronic
1017750520 6:157486959-157486981 CACCTACCAATGCTGTAGCTGGG - Intronic
1018571532 6:165216280-165216302 CACTTCCCAATGCTGTTGCATGG + Intergenic
1019619786 7:1986301-1986323 CACCAACCTCTGCTGCAGCTTGG + Intronic
1022156910 7:27669848-27669870 CACCTCCCAATACTGTTGCATGG + Intergenic
1023215116 7:37854020-37854042 CCCTTACCAATGCTGGAGTTAGG + Intronic
1023355341 7:39361831-39361853 CACCTACAAATGTTTGAGCTCGG + Intronic
1023362114 7:39427719-39427741 GACCTATCAATGCTGTAAATCGG - Intronic
1024738228 7:52328500-52328522 CGCCTACCATTGCTGAGGCTTGG - Intergenic
1028001206 7:85500727-85500749 AACTGCCCAATGCTGTAGCTTGG + Intergenic
1029955234 7:104631824-104631846 CACTTACAAAGGTTGTAGCTAGG - Intronic
1038088466 8:24226970-24226992 CACTTAACATTGCTGTGGCTTGG + Intergenic
1058301809 9:103383199-103383221 TACCTAGCAATGCAGTGGCTGGG - Intergenic
1060069702 9:120535206-120535228 CACCTCCAAATGCTGAAGCTAGG + Intronic
1186921210 X:14282688-14282710 TATCTAGCAATGCTGTTGCTGGG - Intergenic
1187777253 X:22775205-22775227 CACCTACCATACCGGTAGCTGGG - Intergenic
1187821182 X:23290118-23290140 CACCTACCATTGCTGAGGTTAGG + Intergenic
1189259846 X:39670531-39670553 CACCTTCCCATGCTTTGGCTTGG - Intergenic
1194388407 X:93286495-93286517 TACCTACTAATGCTCTAGTTTGG - Intergenic
1196326097 X:114404949-114404971 CACCTCCCAACACTGTTGCTTGG - Intergenic
1199467197 X:148151753-148151775 CACATACCAACTCTGTAGGTGGG + Intergenic