ID: 1017750906

View in Genome Browser
Species Human (GRCh38)
Location 6:157489809-157489831
Sequence ACGCCACTGCACTCCAGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 715583
Summary {0: 20980, 1: 129116, 2: 240855, 3: 208608, 4: 116024}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017750906_1017750909 -2 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750909 6:157489830-157489852 GTGATCATGGCTCACTGCTATGG 0: 1
1: 1
2: 8
3: 38
4: 163
1017750906_1017750914 14 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750914 6:157489846-157489868 GCTATGGGAGTGGGGAAGATTGG 0: 1
1: 0
2: 3
3: 49
4: 351
1017750906_1017750915 15 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750915 6:157489847-157489869 CTATGGGAGTGGGGAAGATTGGG No data
1017750906_1017750912 5 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750912 6:157489837-157489859 TGGCTCACTGCTATGGGAGTGGG No data
1017750906_1017750913 6 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750913 6:157489838-157489860 GGCTCACTGCTATGGGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1017750906_1017750910 -1 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750910 6:157489831-157489853 TGATCATGGCTCACTGCTATGGG No data
1017750906_1017750911 4 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750911 6:157489836-157489858 ATGGCTCACTGCTATGGGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
1017750906_1017750916 22 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750916 6:157489854-157489876 AGTGGGGAAGATTGGGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017750906 Original CRISPR ACGCCACTGCACTCCAGCCT GGG (reversed) Intronic
Too many off-targets to display for this crispr