ID: 1017750907

View in Genome Browser
Species Human (GRCh38)
Location 6:157489810-157489832
Sequence CACGCCACTGCACTCCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696546
Summary {0: 22044, 1: 109955, 2: 188319, 3: 217928, 4: 158300}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017750907_1017750914 13 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750914 6:157489846-157489868 GCTATGGGAGTGGGGAAGATTGG 0: 1
1: 0
2: 3
3: 49
4: 351
1017750907_1017750912 4 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750912 6:157489837-157489859 TGGCTCACTGCTATGGGAGTGGG No data
1017750907_1017750916 21 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750916 6:157489854-157489876 AGTGGGGAAGATTGGGTGTGTGG No data
1017750907_1017750911 3 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750911 6:157489836-157489858 ATGGCTCACTGCTATGGGAGTGG 0: 1
1: 0
2: 0
3: 9
4: 149
1017750907_1017750915 14 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750915 6:157489847-157489869 CTATGGGAGTGGGGAAGATTGGG No data
1017750907_1017750910 -2 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750910 6:157489831-157489853 TGATCATGGCTCACTGCTATGGG No data
1017750907_1017750913 5 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750913 6:157489838-157489860 GGCTCACTGCTATGGGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1017750907_1017750909 -3 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750909 6:157489830-157489852 GTGATCATGGCTCACTGCTATGG 0: 1
1: 1
2: 8
3: 38
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017750907 Original CRISPR CACGCCACTGCACTCCAGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr