ID: 1017750910 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:157489831-157489853 |
| Sequence | TGATCATGGCTCACTGCTAT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1017750906_1017750910 | -1 | Left | 1017750906 | 6:157489809-157489831 | CCCAGGCTGGAGTGCAGTGGCGT | 0: 20980 1: 129116 2: 240855 3: 208608 4: 116024 |
||
| Right | 1017750910 | 6:157489831-157489853 | TGATCATGGCTCACTGCTATGGG | No data | ||||
| 1017750907_1017750910 | -2 | Left | 1017750907 | 6:157489810-157489832 | CCAGGCTGGAGTGCAGTGGCGTG | 0: 22044 1: 109955 2: 188319 3: 217928 4: 158300 |
||
| Right | 1017750910 | 6:157489831-157489853 | TGATCATGGCTCACTGCTATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1017750910 | Original CRISPR | TGATCATGGCTCACTGCTAT GGG | Intronic | ||
| No off target data available for this crispr | |||||