ID: 1017750913

View in Genome Browser
Species Human (GRCh38)
Location 6:157489838-157489860
Sequence GGCTCACTGCTATGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017750906_1017750913 6 Left 1017750906 6:157489809-157489831 CCCAGGCTGGAGTGCAGTGGCGT 0: 20980
1: 129116
2: 240855
3: 208608
4: 116024
Right 1017750913 6:157489838-157489860 GGCTCACTGCTATGGGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 158
1017750907_1017750913 5 Left 1017750907 6:157489810-157489832 CCAGGCTGGAGTGCAGTGGCGTG 0: 22044
1: 109955
2: 188319
3: 217928
4: 158300
Right 1017750913 6:157489838-157489860 GGCTCACTGCTATGGGAGTGGGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017750913 Original CRISPR GGCTCACTGCTATGGGAGTG GGG Intronic