ID: 1017750913 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 6:157489838-157489860 |
Sequence | GGCTCACTGCTATGGGAGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 169 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 158} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1017750906_1017750913 | 6 | Left | 1017750906 | 6:157489809-157489831 | CCCAGGCTGGAGTGCAGTGGCGT | 0: 20980 1: 129116 2: 240855 3: 208608 4: 116024 |
||
Right | 1017750913 | 6:157489838-157489860 | GGCTCACTGCTATGGGAGTGGGG | 0: 1 1: 0 2: 0 3: 10 4: 158 |
||||
1017750907_1017750913 | 5 | Left | 1017750907 | 6:157489810-157489832 | CCAGGCTGGAGTGCAGTGGCGTG | 0: 22044 1: 109955 2: 188319 3: 217928 4: 158300 |
||
Right | 1017750913 | 6:157489838-157489860 | GGCTCACTGCTATGGGAGTGGGG | 0: 1 1: 0 2: 0 3: 10 4: 158 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1017750913 | Original CRISPR | GGCTCACTGCTATGGGAGTG GGG | Intronic | ||