ID: 1017751208

View in Genome Browser
Species Human (GRCh38)
Location 6:157492083-157492105
Sequence CTGCCTGGAGGGCTGCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 429}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017751208_1017751216 5 Left 1017751208 6:157492083-157492105 CCATCCAGCAGCCCTCCAGGCAG 0: 1
1: 0
2: 3
3: 59
4: 429
Right 1017751216 6:157492111-157492133 GTCACTGTCCCCTCTCACCGGGG 0: 1
1: 0
2: 0
3: 16
4: 169
1017751208_1017751214 3 Left 1017751208 6:157492083-157492105 CCATCCAGCAGCCCTCCAGGCAG 0: 1
1: 0
2: 3
3: 59
4: 429
Right 1017751214 6:157492109-157492131 CTGTCACTGTCCCCTCTCACCGG 0: 1
1: 0
2: 1
3: 30
4: 261
1017751208_1017751215 4 Left 1017751208 6:157492083-157492105 CCATCCAGCAGCCCTCCAGGCAG 0: 1
1: 0
2: 3
3: 59
4: 429
Right 1017751215 6:157492110-157492132 TGTCACTGTCCCCTCTCACCGGG 0: 1
1: 0
2: 2
3: 30
4: 356
1017751208_1017751221 16 Left 1017751208 6:157492083-157492105 CCATCCAGCAGCCCTCCAGGCAG 0: 1
1: 0
2: 3
3: 59
4: 429
Right 1017751221 6:157492122-157492144 CTCTCACCGGGGAGGAAACCCGG 0: 1
1: 0
2: 1
3: 11
4: 159
1017751208_1017751223 29 Left 1017751208 6:157492083-157492105 CCATCCAGCAGCCCTCCAGGCAG 0: 1
1: 0
2: 3
3: 59
4: 429
Right 1017751223 6:157492135-157492157 GGAAACCCGGCCTTTTCCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 106
1017751208_1017751217 8 Left 1017751208 6:157492083-157492105 CCATCCAGCAGCCCTCCAGGCAG 0: 1
1: 0
2: 3
3: 59
4: 429
Right 1017751217 6:157492114-157492136 ACTGTCCCCTCTCACCGGGGAGG 0: 1
1: 0
2: 1
3: 8
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017751208 Original CRISPR CTGCCTGGAGGGCTGCTGGA TGG (reversed) Intronic
900089265 1:912577-912599 CTGACTGGAGGGATCCAGGAAGG + Intergenic
900104164 1:975283-975305 CTGCCTGGCTGGGTGCTGGGTGG - Exonic
900204495 1:1426266-1426288 CTGCCCGGCCGGCTGCTGGCCGG + Exonic
900425517 1:2576647-2576669 GTGCCCAGAGGGCGGCTGGAGGG + Intergenic
900569404 1:3351006-3351028 CTGTCTGCAGAGCTGCTGGTTGG + Intronic
900796360 1:4711008-4711030 CTCCCCGGAGGGCTGCAGAAAGG - Intronic
900895348 1:5479362-5479384 CTGCCTGTGGGGATGCAGGAAGG + Intergenic
900935806 1:5765718-5765740 CGTCCTGGAGGGCTGCTGCCAGG - Intergenic
901205655 1:7494402-7494424 CTGCCAGGAGGGCTGAGGCATGG + Intronic
901223008 1:7594578-7594600 CGGCCTGCAGAGCTACTGGAAGG + Intronic
901519804 1:9774811-9774833 CAGCCCTGAGGGCTGCTGGTCGG + Intronic
902942559 1:19811250-19811272 CTGCCTCCAAGGCTGCTGCATGG + Intergenic
902991986 1:20194413-20194435 CTGCCTTGAAGGCTGTTGGCTGG - Exonic
903016964 1:20367437-20367459 CTGGCTGGAGGTCTGCAGGTGGG - Intergenic
903137741 1:21320377-21320399 TTGCCTGCAGGGCTCATGGAAGG + Intronic
903744631 1:25578294-25578316 CTCTCTGGAGGGCTGCTTGAGGG - Intergenic
903768347 1:25748939-25748961 CTGCCGGGAGAGCTGCTGGCTGG - Intronic
903927229 1:26839216-26839238 CTGCCTGGAAGGCAGCAGGAGGG + Intronic
903974666 1:27141679-27141701 CTGCCTGCCTGGCTGGTGGAAGG - Intronic
904255993 1:29255208-29255230 TGGCCAGGAGGGCTCCTGGAGGG - Intronic
904527823 1:31147405-31147427 CTGCCACAAGGGCTGCTGGTTGG + Intergenic
904910221 1:33929098-33929120 TTTCCTGGAGGGCTGGTGGGTGG - Intronic
905270576 1:36784968-36784990 CTGCATGGAAGGCTGCTGCAAGG - Intergenic
905328088 1:37172221-37172243 CTGCTGGGAGTGCTGGTGGAAGG - Intergenic
905867037 1:41382153-41382175 CTGCCCGAGGGCCTGCTGGACGG + Exonic
906019265 1:42613166-42613188 CTGCCCCGAGGGCTGCTGGTTGG + Intronic
906673987 1:47679975-47679997 CAGCCTTGAGGGGTGGTGGAGGG - Intergenic
907405203 1:54249820-54249842 TGACCTGGAGGGCTGTTGGAAGG - Intronic
907769639 1:57447779-57447801 CTGCCTGGCTGGCTGCTGATGGG - Intronic
908061705 1:60356994-60357016 CTGGCTGGAGGGCTGTTGTGTGG - Intergenic
908992283 1:70106709-70106731 ATGGCTGGAGTGCTGATGGAAGG - Intronic
911039071 1:93578176-93578198 CTGCCTTGGAGGCTGCTGCACGG + Intronic
912388423 1:109284521-109284543 CAGCCCGGAGGGCTGCTGGTTGG - Intergenic
912714096 1:111969862-111969884 TTTCCTGGGGGGATGCTGGATGG + Intronic
915069136 1:153251576-153251598 CTCCCTGGTAGGCTGCTGGAAGG - Intergenic
915102039 1:153507660-153507682 CTTCCAGGAGGGCTTCTGGGTGG - Intergenic
915460235 1:156066115-156066137 GGGCCTGGGGGGCTGCTGGGTGG + Intronic
916687663 1:167161864-167161886 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
917927754 1:179803361-179803383 CTGCCTGGATGAATGCTGGCAGG - Intronic
917964211 1:180168249-180168271 CTGCCTGGCTGGCTGTGGGAGGG + Intronic
918041474 1:180916542-180916564 CTGCCTGATGGGCAGCTGGACGG + Exonic
918098877 1:181356590-181356612 CTCCCTGAAGGCCTGCTGGCAGG - Intergenic
919882102 1:201907582-201907604 CTGCCTGGAGGGCTACAAGCTGG + Intronic
921187583 1:212683550-212683572 CTGCCTGCTGGGCTGAAGGAAGG - Intergenic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
924568203 1:245215269-245215291 CTGGCTGGAGGGCACCTGGCTGG - Intronic
1062885382 10:1011973-1011995 CTGCCTGCTGGGCTCCTGGCCGG + Intronic
1063204718 10:3819904-3819926 CCGCATGGAGGCCTGATGGAAGG + Intergenic
1064249783 10:13698070-13698092 ATGCATGGAGAGCTGATGGAGGG + Intronic
1064263392 10:13804465-13804487 CTGCCAGGAAGGCTGGTGCACGG - Intronic
1064559004 10:16577261-16577283 TGGCCTGGAGGGAAGCTGGATGG + Intergenic
1064751844 10:18538242-18538264 CTATCTGGAGGCCTACTGGAAGG + Exonic
1065220414 10:23490907-23490929 CTCCCTGTAGGGTTGCTGAATGG + Intergenic
1065859457 10:29859342-29859364 CTGCCAGCAGGGCAGCTGGGAGG - Intergenic
1066393237 10:34995669-34995691 CTCCCTGAAGTCCTGCTGGAAGG - Intergenic
1067047051 10:42990771-42990793 GTGTCTGGAGGGCCGCAGGAGGG - Intergenic
1067067342 10:43111406-43111428 CTGCCTAGAGGTCTGCTGGTCGG - Exonic
1067314718 10:45150988-45151010 CTGCCGTGGGGGCTGCTGGTTGG - Intergenic
1067338149 10:45380481-45380503 CTGCCAGGAGGACCCCTGGAGGG - Intronic
1068980294 10:63055869-63055891 CTGGATTGAGGGCTGCTAGATGG + Intergenic
1069346548 10:67476887-67476909 ATGCCTGGAGATCTGCTTGAGGG - Intronic
1069792084 10:71029335-71029357 CTGTCTGGCAGGCTGCTGGCTGG - Intergenic
1070634872 10:78117219-78117241 CTGTCTGGGGGGCTGTTGCAGGG - Intergenic
1070794427 10:79208406-79208428 CTGCTCGAAGGGCCGCTGGAAGG - Exonic
1071665005 10:87546102-87546124 TAGCCTTGAGGGCTGCTGGTTGG + Intronic
1074081406 10:110170659-110170681 CAGCCTGGGGGGTTGCAGGAGGG + Intergenic
1074363201 10:112838987-112839009 CTTCCCTGAGGGCTGCTGGCTGG + Intergenic
1075853781 10:125610209-125610231 CAGCCCTGAGGGCTGCTGGTTGG - Intronic
1076135004 10:128039729-128039751 CAGGCAGGAGGGCTGCTGGTGGG + Intronic
1076240881 10:128906359-128906381 GTGCCTAGAGGGCTGTTGGGAGG - Intergenic
1076394060 10:130125661-130125683 CTGCCCTGAGGGCTGATGGTAGG - Intergenic
1076429493 10:130391641-130391663 CAGCCTGCAGGGCTCATGGAGGG + Intergenic
1076510505 10:131011084-131011106 CTGCCGGGAGGCCTCCTGGGAGG + Intergenic
1076590368 10:131578287-131578309 ATTCCTGGGGGGCTGCTGGAGGG + Intergenic
1076881038 10:133239360-133239382 CGGCCTGGAAGGCTGTGGGAAGG + Intronic
1077001733 11:326801-326823 GGGCCTGGAGGGCTGCTGTGGGG - Intronic
1077302548 11:1853992-1854014 ATGCCTGGATGCCTGCTGGCCGG - Intronic
1077358869 11:2130928-2130950 CTCCCTGGTGTGCTCCTGGAAGG - Intronic
1077557438 11:3232384-3232406 CTGCCTGGAAGGCTGCAGGGAGG - Exonic
1078430088 11:11281769-11281791 CTGCCTGAAGGGATGTGGGAAGG + Intronic
1078910268 11:15724525-15724547 CTCCCTGCTGGGCTGCAGGAAGG - Intergenic
1079325102 11:19484871-19484893 CTGTCTGGATGGGTGCTGGCTGG - Intronic
1079396137 11:20065543-20065565 TTCCCAGGAGAGCTGCTGGATGG + Intronic
1079970680 11:27031880-27031902 CTGCTTGCAGGGCAGCTAGAGGG + Intergenic
1080684711 11:34505484-34505506 AGGGCTGGAGGGCTCCTGGATGG - Intronic
1080819936 11:35795956-35795978 CTACCAGAAGAGCTGCTGGAAGG - Intronic
1083048328 11:59755660-59755682 CTGCCAGGAGGGGTGCTGCATGG + Intronic
1083233641 11:61338551-61338573 TCTCCTTGAGGGCTGCTGGAGGG + Intronic
1083510970 11:63209238-63209260 CTGCCTAGAGGGATACTGCAAGG + Intronic
1084461447 11:69298787-69298809 CTGGCTGTAGGGCTGCGGGCCGG - Intronic
1084500071 11:69530202-69530224 CTGCCAGGAGGTCTCCTAGATGG + Intergenic
1088544347 11:110944903-110944925 CTGAATGGAGTGCTGCAGGAAGG - Intergenic
1088582291 11:111327952-111327974 CTGGCTAGAGGGCGGCTGGCAGG - Intergenic
1089004908 11:115083391-115083413 CTGCATGGAGGGAGGCAGGAAGG - Intergenic
1089119728 11:116125083-116125105 CTGTCAGGAGGGCTGCTGTGGGG - Intergenic
1089133639 11:116232108-116232130 CTGCTTGAAGGGCTGGGGGAAGG - Intergenic
1089254487 11:117187070-117187092 CTGTCTGGAGGGCTCGTGGGCGG + Intronic
1089365001 11:117916072-117916094 CTGCTGGCAGGGCTGCTGAAGGG - Intronic
1089496573 11:118911200-118911222 GCTGCTGGAGGGCTGCTGGAGGG - Intronic
1089576322 11:119447008-119447030 CTGCTTGAAGAGCTGCTGAAAGG - Intergenic
1090265459 11:125350667-125350689 CTGCCTGGAGGCCTTGGGGAAGG - Intronic
1090809305 11:130222628-130222650 CTGGCTGGAGGGGTGAGGGAAGG - Intergenic
1090976117 11:131682291-131682313 CTGCCTGGAAGGCTGCTGTGAGG + Intronic
1090982568 11:131736336-131736358 AAGCCTGGAGGGTTACTGGAAGG - Intronic
1091387199 12:103000-103022 CTTCCTGGCTGGCTGCTGGGAGG - Intronic
1091440458 12:508703-508725 CAGCCTGGAGCTCTGCTGGAAGG - Intronic
1091930242 12:4390123-4390145 CTGCAGTGAGGGGTGCTGGAAGG - Intergenic
1092122860 12:6056822-6056844 CGGCCCGGAGGGCTGCGGGCAGG + Intronic
1092154496 12:6273697-6273719 CTCCCTGCTGGGCTGCTGGTGGG - Intergenic
1092822546 12:12366040-12366062 CTGCCTGCTGGGCTGCTGCAGGG + Intronic
1094062029 12:26324574-26324596 CTGCCTTTAGGACTGCTGGAAGG + Intergenic
1096513560 12:52144752-52144774 GGGCCTGGATGGCAGCTGGAGGG + Intergenic
1097261579 12:57723501-57723523 CTGCAGGGAGGGCTGGCGGATGG + Intergenic
1097289088 12:57898832-57898854 AACCCTGCAGGGCTGCTGGAAGG - Intergenic
1097733201 12:63151995-63152017 CTGCCTGGATGGCCGCTGTCCGG - Intergenic
1098640667 12:72835226-72835248 CAGCCCAGAGGGCTGCTGGTTGG + Intergenic
1101404546 12:104416400-104416422 CTGCCTGGAGGAGTGAGGGAAGG + Intergenic
1101727091 12:107396796-107396818 CTGCCTGGAGGGAAGGAGGAAGG - Intronic
1101794873 12:107963848-107963870 CTCCCTGGGGGGCTGATTGATGG - Intergenic
1102261420 12:111445654-111445676 CTCCCAGGAGACCTGCTGGAAGG + Intronic
1102952958 12:117042282-117042304 CTCCCTGGGGGGCTGGGGGAGGG - Intronic
1104721567 12:131047448-131047470 CTCCCTGGATGGCTGCGGAAGGG - Intronic
1104765948 12:131330394-131330416 ATTCCTGGAGGGCTGCTTGGTGG - Intergenic
1104826646 12:131714966-131714988 CTGCCTGGACTGCTGGTGTAGGG + Intronic
1104968409 12:132520229-132520251 GTGCAAGGAGGGTTGCTGGAGGG - Intronic
1106334203 13:28767810-28767832 CAGCCTTGGGGGCTGCTGGTTGG + Intergenic
1110711820 13:78658797-78658819 CTGCCGGGAGGGCGGCGAGACGG - Intronic
1113413616 13:110111023-110111045 CTGCGTGGAGGGCTGCGTGGCGG + Intergenic
1113881583 13:113629808-113629830 CTGCCTGGAGGACAGCGGCACGG + Intronic
1114647913 14:24265845-24265867 CTGCCTGGAAGTCTGTTTGATGG + Intronic
1117527410 14:56623437-56623459 CTGAGTGGAGGTCTGCTGGGGGG - Intronic
1118063413 14:62165202-62165224 CTGTGTGGAGGGCTGCTGTGAGG + Intergenic
1118301969 14:64624356-64624378 TGGCCTGGAGGGCTCATGGAAGG + Intergenic
1118318774 14:64741443-64741465 CAGCCTGGAGGGCAGCGAGAAGG + Exonic
1118347728 14:64951866-64951888 CTGCCAGGAGGGCAGTTGGCAGG - Intronic
1118617731 14:67586416-67586438 CTGCCTTGAGGACTGCTGCAAGG - Intronic
1118949356 14:70419873-70419895 CAGCCCCGAGGGCTGCTGGTTGG - Intergenic
1120766306 14:88329951-88329973 CTGCCTACAGGGTTGCTGTAAGG + Intergenic
1121106134 14:91281185-91281207 CAGCCTGGAAGGGTGCTTGAAGG + Intronic
1121666935 14:95679748-95679770 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
1121704205 14:95979077-95979099 CTGGCTGGAGGGGAGCTGGGTGG - Intergenic
1122346173 14:101061880-101061902 CTGCCTGGGGGGCTTCTCGGAGG + Intergenic
1122938095 14:104969144-104969166 CTGCCTCCAAGGCTGCAGGAGGG + Intronic
1122971432 14:105153825-105153847 CTCCCTGGATGGCTGCTGGCTGG - Intronic
1123060390 14:105591767-105591789 CTGCCAAGAGGGCTGCTGTGGGG + Intergenic
1123084868 14:105712738-105712760 CTGCCAAGAGGGCTGCTGTGGGG + Intergenic
1124216890 15:27815059-27815081 CTTCCTGGAGGGCTGTGGGAAGG + Intronic
1124706679 15:31972306-31972328 CTGCCTCCAGGGCTGCTGAGTGG - Intergenic
1125519546 15:40340277-40340299 CTCCCTGGAGAGCTGGGGGAGGG - Intronic
1125878278 15:43168665-43168687 CTGCCTGGAGAGTTGGGGGATGG + Intronic
1127279772 15:57479061-57479083 CTTCCTGGAGAGCTGGGGGAAGG - Intronic
1127632679 15:60841384-60841406 CTGCCAGGCGAGCTGCTGGTTGG - Intronic
1127675262 15:61232132-61232154 CTGCATGGATGGCTGCAGAAAGG - Intergenic
1127758324 15:62113950-62113972 CTGCCCTGAGGGCAGGTGGAGGG - Intergenic
1127919128 15:63479588-63479610 CCTCCTGGAGGCCTGCTCGAGGG - Intergenic
1128115241 15:65101198-65101220 CTGACTGTGGGGCTGCTGGGGGG + Intronic
1128593743 15:68926270-68926292 CTAACTGGAGGGATGATGGAGGG + Intronic
1129689877 15:77707126-77707148 CTGCAGGCAGGGATGCTGGAGGG + Intronic
1130832603 15:87616744-87616766 CTGTCTGGAGGGCTGATGGGTGG + Intergenic
1130841653 15:87706443-87706465 CTGCCTGGACGTCTTCTGGCTGG - Intergenic
1131048627 15:89332506-89332528 CTGCTTGGAAGGCTGGGGGAAGG + Intronic
1131330825 15:91497649-91497671 AGGACTGGAGGCCTGCTGGAAGG - Intergenic
1131975129 15:97936786-97936808 CAGCCTGCAGGGCTGATAGAGGG - Intergenic
1132117874 15:99150852-99150874 CTGGCTGTAGGGTTGCTGGTGGG - Intronic
1132382111 15:101373207-101373229 CTGCCTGCAGGGAGGCTGGCTGG + Intronic
1132794740 16:1714186-1714208 CTGCCTGCAGGGGAGCTGGGCGG + Intronic
1134227207 16:12400259-12400281 CTGCCAGGATGGCTGGTGCAGGG - Intronic
1135994175 16:27235938-27235960 GTGCCCAGAGAGCTGCTGGAGGG - Intronic
1136008766 16:27348763-27348785 CTGCCTCTAGGGCTGCAGGTGGG + Intronic
1136028228 16:27483799-27483821 CTGCCTAGCTTGCTGCTGGAGGG + Intronic
1137247493 16:46717595-46717617 CTGCCTGGAGGGGAGGTGGGGGG - Intronic
1137804266 16:51288629-51288651 CTGGCTGGAAGGCTGGTGGAAGG - Intergenic
1138207967 16:55138921-55138943 CTGCCTGGAGGGATGCAGGGAGG - Intergenic
1138249334 16:55490130-55490152 CCGCCTGGAGGGTGGCTGAAGGG - Intronic
1138249933 16:55494074-55494096 CTGGCTGGATGGATGATGGATGG - Intronic
1141901863 16:86996236-86996258 CTGCCTGGAGGGGCTCTGGTGGG + Intergenic
1142032046 16:87843482-87843504 TGGCCTGGAGGGCTGCAGGAGGG + Intronic
1142204198 16:88775021-88775043 CTCCCTGGGTGTCTGCTGGATGG - Intronic
1142755327 17:2013305-2013327 CTGCCAGGAGGGCTAGTGGCAGG + Intronic
1143183261 17:4997130-4997152 CTGCCTGGAGCCCCGCTGGAGGG + Intronic
1143398628 17:6625088-6625110 CTGGCTGGAGGGGAGCTTGATGG - Intronic
1144273183 17:13639441-13639463 CAGCCCTGAGGGCTGCTGGCTGG - Intergenic
1144769373 17:17751109-17751131 CTGCATGGAGGGCTGCTAAGGGG - Intronic
1145226320 17:21131228-21131250 CAGCCCTGAGGGCTGCTGGCTGG + Intronic
1146974518 17:37099435-37099457 CTGCCTGGAGGGCTGATGGCGGG + Intronic
1146974574 17:37099615-37099637 ATGGCAGGAGGGCTGATGGAGGG + Intronic
1147996475 17:44362802-44362824 ATGCCAGGAGGCCTGCTGAATGG + Intronic
1148143604 17:45345501-45345523 TGGCCTTGAGGGTTGCTGGAAGG - Intergenic
1148592207 17:48824881-48824903 CAGCCTGGTGGGCTGCTGGTTGG + Intergenic
1148669924 17:49402837-49402859 CTCCCGGGATGGCTGCTGGGAGG + Intronic
1148719363 17:49739800-49739822 CTGGCTGGGTGGCTGCAGGAGGG + Intronic
1149456779 17:56794583-56794605 CAGCCTTGAAGGCTGCAGGAAGG + Intronic
1149656660 17:58312707-58312729 CTGCCAGGAGAGCTCATGGATGG - Exonic
1149667258 17:58373938-58373960 ATGGATGGAGGGTTGCTGGATGG - Intronic
1150182434 17:63138510-63138532 CTGCTTGGACGGTTGTTGGAAGG + Intronic
1151162014 17:72173852-72173874 CTGCCTGGGGTGGTCCTGGAGGG - Intergenic
1151360099 17:73583673-73583695 CTGCCTGGAGGGAAGATGCAGGG + Intronic
1151539411 17:74757587-74757609 CTGCCTGGAGTGCTGTGTGACGG - Intronic
1151555970 17:74846952-74846974 GTGCCTGGAAGGCTGGAGGAAGG - Intronic
1151930692 17:77229874-77229896 CTGCCAGGAATGCTGCTGGCTGG - Intergenic
1152250988 17:79212437-79212459 CTTCCTGTAGGACTGCTGCAGGG + Intronic
1152467406 17:80474062-80474084 CTGCCTGGAGCTCTGCTGAGAGG + Intronic
1152721331 17:81925150-81925172 CAGCCTTGAGGGCTGGAGGAGGG - Intronic
1153682217 18:7511475-7511497 CAGCCCCGAGGGCTGCTGGTTGG - Intergenic
1153884281 18:9449080-9449102 TTTCCTGGAGGGCTGTTGCAGGG - Intergenic
1154328162 18:13407030-13407052 CGGCGTGGCGGGCTGCAGGACGG + Intronic
1156036036 18:32769659-32769681 CTGCCTGCAGTGCTGCCTGAAGG + Exonic
1156497574 18:37536207-37536229 CTCCCTGGAGGGGTGATGGGAGG + Intronic
1157048850 18:44136042-44136064 CTGCCCTGAGGGCTGCCGGTTGG - Intergenic
1157258883 18:46161754-46161776 CAGCCCCGAGGGCTGCTGGTTGG + Intergenic
1158144085 18:54290827-54290849 CTGGATGGAGGGCTGAGGGAGGG + Intronic
1158844641 18:61428849-61428871 ATGGCTGGAGGGCTGGTGGGTGG - Intronic
1159021446 18:63146319-63146341 CTGCCAGGAGGCGGGCTGGAAGG - Intronic
1160033307 18:75280895-75280917 CTCCCTGGAGGGATGAGGGAGGG + Intronic
1160355513 18:78225215-78225237 CAGCCAGTATGGCTGCTGGAGGG - Intergenic
1160409727 18:78667652-78667674 AGGCCCTGAGGGCTGCTGGAAGG + Intergenic
1160711369 19:552708-552730 GTGTCTGGAGGCCGGCTGGACGG + Intergenic
1160883130 19:1331584-1331606 CTGCCTGGGGAGGGGCTGGAAGG + Intergenic
1160983516 19:1827340-1827362 CTTCCTGTCGGGCAGCTGGAGGG + Exonic
1161256464 19:3312710-3312732 CAGCCTGGGGGGCTCCTGGAGGG - Intergenic
1161479101 19:4501840-4501862 CTGCCTGTAGGGCGGTTGGGTGG - Intronic
1161586688 19:5109501-5109523 CTGCCCGGCAGGCAGCTGGAGGG + Intronic
1161627674 19:5336768-5336790 CTGCCTGGTGAGCGGTTGGAGGG + Intronic
1161640748 19:5421179-5421201 CTGGCTGGAGGGGTGGGGGACGG + Intergenic
1161750442 19:6092389-6092411 CTGCATGCTGGGCTGCTGGAAGG + Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1162727934 19:12701077-12701099 CTGCCAGGAGGGCAAGTGGACGG + Exonic
1163129963 19:15266152-15266174 CTGCCTGCACAGCTGCTGGGAGG - Intronic
1163196928 19:15728469-15728491 CTGCCTGGTGGGCTGCTCCTGGG + Exonic
1163206544 19:15807590-15807612 CTGCCTGGTGGGCTGCTCCTGGG - Exonic
1163486677 19:17591764-17591786 CTGCCAGGATGGCTGGTGGTGGG + Intergenic
1163512086 19:17741428-17741450 CTAGCTGGAGGGCTTCTTGAAGG + Intergenic
1164700154 19:30279333-30279355 CTGACTGCAGGGGTGCTGGGTGG + Intronic
1165339931 19:35204179-35204201 CTGCATGTAGGGAGGCTGGACGG - Intergenic
1165508383 19:36249704-36249726 CTTCTTGGTGGGCTCCTGGATGG - Intergenic
1165632162 19:37311074-37311096 CTTCTTGGTGGGCTCCTGGATGG + Intergenic
1166310738 19:41961055-41961077 GTGCTTTGAGGCCTGCTGGAAGG + Intergenic
1166328571 19:42065873-42065895 CCCCTTGGAGGCCTGCTGGATGG + Intronic
1166401831 19:42487231-42487253 CAGCCCTGAGGGCTGCTGGTTGG + Intergenic
1166733660 19:45072070-45072092 CTGCATGGAAGGGTGCTGGTGGG + Exonic
1166938588 19:46349820-46349842 CTGCCTGGAGAGAGGGTGGACGG + Intronic
1167030405 19:46955462-46955484 CTGCCAAGAAGGCTGCTGAAAGG - Intronic
1167145559 19:47679553-47679575 CTGCAGGGTGGGCAGCTGGAAGG - Exonic
1168148830 19:54434238-54434260 CTGGCTGGCTGGCTGCTGCATGG - Intronic
925431825 2:3801354-3801376 CACCCTGAAGGGCTGCTGGGAGG + Intronic
925892044 2:8442166-8442188 CTGGCTGGAGGGCTGCCTGCAGG - Intergenic
925892751 2:8448994-8449016 CTCCCTGGTGGGCTGTTGGCAGG - Intergenic
926322309 2:11757596-11757618 TTGCCTGGAGGGGTGCAGGCAGG - Intronic
926946061 2:18188660-18188682 TTGACTGCAGGGCTGCTGGGAGG + Intronic
927248878 2:20980718-20980740 GTGCCTGAAGGGCAGCTGGAAGG + Intergenic
927962644 2:27250418-27250440 CGGGCGGGAGGGCTGCTGGAGGG + Intergenic
929782711 2:44967550-44967572 CTCCCTGGAGGTCTGAGGGAAGG + Intergenic
929994796 2:46818514-46818536 CTCCCTGTAGGGCTGTGGGAGGG + Intronic
930800386 2:55437772-55437794 CTGCCATGATGGCTGCAGGAGGG + Intergenic
931254191 2:60555619-60555641 TTGCCGGCAGGGCTGCGGGATGG - Intergenic
931632883 2:64317117-64317139 CTGCCTGGTGAGCAGCTGCAGGG - Intergenic
932468645 2:71939815-71939837 CAGCCTGCAGGGCTCTTGGAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
932813551 2:74843934-74843956 CTACCTGGAGGGCAGCTTGAGGG - Intronic
933061741 2:77746266-77746288 CAGACTGGAGGGCTTCTGTAAGG + Intergenic
933834448 2:86233970-86233992 CTGACAAGAGGGCTGCTGGTGGG + Intronic
934555249 2:95283581-95283603 CAGCCTGGAGGGATGCGGGGAGG + Intronic
934558462 2:95299924-95299946 CTGCCTTGTGGGCTGCGTGAGGG - Intronic
934851972 2:97707318-97707340 CTGCGTGGAGAGCTGGGGGAGGG + Intergenic
935067363 2:99661234-99661256 CTGCCAGCAGGGTTGCTGGTTGG - Intronic
935141112 2:100353869-100353891 CTGGCTGGAGGGTGGCTGGAGGG + Intergenic
935810770 2:106794832-106794854 CTACCTCGAGGTCTGCTGGAAGG + Intergenic
937318316 2:120946107-120946129 CTGCCTGGAAGTGTGCAGGAAGG - Intronic
937646536 2:124271510-124271532 CTGCATGCAGGACTGATGGAAGG + Intronic
937977513 2:127590651-127590673 CTGTCTGCAGGGCTGGTGAAAGG - Intronic
938114968 2:128596613-128596635 CTGACTGGAATGCCGCTGGACGG + Intergenic
938249460 2:129802800-129802822 TTGCCTGGAGGCCTGGGGGAGGG + Intergenic
938550190 2:132373240-132373262 CAGCCCTGAGGGCTGCTGGTTGG + Intergenic
938781604 2:134589700-134589722 CAGCCCTGAGGGCTGCTGGTTGG - Intronic
939565794 2:143785187-143785209 CTGCCTTGTTGCCTGCTGGACGG - Intergenic
942596747 2:177598866-177598888 CTGCCTGGATGGCTGTAGGCTGG - Intergenic
942761288 2:179400744-179400766 CTGCCTCGGGGCCTTCTGGATGG + Intergenic
943667744 2:190628034-190628056 CTGCCAGGGGAGCAGCTGGAGGG - Intergenic
944516283 2:200514868-200514890 CTTCCAGGAGAGCTGCAGGAGGG - Intronic
946115377 2:217457333-217457355 CTCCTTGGAGGGATGCTGGTTGG - Intronic
947637439 2:231687366-231687388 CGGCCTGGGGGGCTCCTCGAGGG - Intergenic
947860284 2:233353574-233353596 TTCCCAGGGGGGCTGCTGGATGG - Intergenic
1168895646 20:1321578-1321600 CTGTCTGGAGAGCAGCAGGACGG - Intronic
1169046305 20:2536856-2536878 CTCCTTGCAGGGCTACTGGAAGG + Intronic
1169806545 20:9566094-9566116 CACCCTGGAGGGCTGCTGGTCGG + Exonic
1170424023 20:16220405-16220427 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
1170606998 20:17882193-17882215 GGGCCTGGAGGGCTGCTTGTAGG + Intergenic
1170634572 20:18093236-18093258 CAACAAGGAGGGCTGCTGGATGG + Intergenic
1171009874 20:21503402-21503424 CTGCCTGGAGGTGAGCAGGAGGG - Intergenic
1171085433 20:22234259-22234281 CTGCGTGCAGGGCTGCTGAAAGG + Intergenic
1172035413 20:32007282-32007304 CTGCCTGGAGGGCTGCGTAGAGG - Intergenic
1172097071 20:32465704-32465726 CTTCCGGGAGGGCTGGAGGAGGG - Intronic
1172826373 20:37790614-37790636 CAGCCTGGAGGACTGTTGGAAGG - Intronic
1173148985 20:40549857-40549879 CTGGCTGGAGGGTAGATGGATGG - Intergenic
1173532615 20:43782026-43782048 TAGCCTCGAGGGCTGCTGGTTGG + Intergenic
1173686965 20:44930683-44930705 GTAGCTGGAGGGCTGCTGAAAGG - Exonic
1174089822 20:48037993-48038015 CTGCCTTAGGGGCTGCAGGAGGG - Intergenic
1174126472 20:48310574-48310596 CTGCCTTAGGGGCTGCTGGCGGG + Intergenic
1174271328 20:49371514-49371536 CTGCATCGATGGCTGCAGGAAGG + Exonic
1174353501 20:49983830-49983852 CTGGTCGTAGGGCTGCTGGAAGG - Exonic
1175009435 20:55720279-55720301 CAGCCCTGAGGGCTGCTGGTTGG + Intergenic
1175773257 20:61636857-61636879 CTGCATGGAGGGCAGCTAGCTGG + Intronic
1175884307 20:62280254-62280276 CTGCCTGGATGGTGGCTAGAAGG + Intronic
1176129064 20:63488585-63488607 CTGCCTGGGCGGCTGCTCCACGG + Intronic
1176133212 20:63505930-63505952 CTGCCTGGAGCCCTGCTTGTGGG + Intergenic
1176231665 20:64036175-64036197 CTGCCTGGAGGACTGCAGAGGGG - Intronic
1178519851 21:33280137-33280159 CTCCCTGAAGGGCAGCTGCAGGG + Intronic
1179183329 21:39063107-39063129 CAGGCAGCAGGGCTGCTGGATGG + Intergenic
1179960004 21:44762799-44762821 CTGCCTGCAGGGCTGCTCTGGGG + Intergenic
1181431441 22:22884151-22884173 CTGCCTGGAGTGCAGCTGTAAGG - Intronic
1182467832 22:30528942-30528964 CTGCCTGGTGGGCTGCCAGGTGG - Intronic
1182796780 22:32996828-32996850 CTGCCCGGAGGGCTCCAGCAGGG + Intronic
1183067239 22:35371769-35371791 CAGCCTTCAGGGCTGCTGGTAGG - Intergenic
1183100012 22:35578237-35578259 CTGGCTGGATGGATGGTGGATGG + Intergenic
1183358589 22:37372023-37372045 ATGCCTGGAGGGCTGCAGGGAGG - Exonic
1184769282 22:46588338-46588360 CTGCCTGGAGGGATGGAAGACGG - Intronic
1185011879 22:48319120-48319142 CTGGCTGGTGGGATGCTGAATGG - Intergenic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
1185182759 22:49372688-49372710 CTGACTGGAAGGCTGCAGGGAGG - Intergenic
952000285 3:28777370-28777392 GTGACTGGAGGGCTGGTGGAGGG + Intergenic
952449249 3:33415883-33415905 GTACCTGGAGGGCACCTGGAAGG - Intronic
953003973 3:38960388-38960410 CTGCCTGGAGCCCTTCTGGGAGG + Intergenic
953334258 3:42080445-42080467 CTGCCTAGAGAGCTGCAGGAAGG - Intronic
954315140 3:49797109-49797131 GTGCCTGCTGGGTTGCTGGAGGG - Intronic
954448877 3:50561110-50561132 GGGCCTGGAGGGCTGCTGGGAGG - Intronic
954464189 3:50645125-50645147 CTTCCTGGAGGGCTGCTGAAGGG + Intronic
954837091 3:53479421-53479443 CAGCAGGGAGGGATGCTGGAAGG + Intergenic
954921739 3:54197222-54197244 CTGCTTGAAGAGCTGATGGAAGG - Intronic
956326122 3:68055014-68055036 CTGCCTGAAGGTCTGCTTGTGGG - Intronic
957174173 3:76784283-76784305 CTGACTAGAGGGATTCTGGAGGG + Intronic
957215731 3:77317664-77317686 CTGCTGGGGGGGCTGCTGGGGGG + Intronic
957215753 3:77317721-77317743 CTGCTAGGGGGGCTGCTGGGGGG + Intronic
957215759 3:77317733-77317755 CTGCTGGGGGGGCTGCTGGGGGG + Intronic
957215782 3:77317790-77317812 CTGCTAGGGGGGCTGCTGGGGGG + Intronic
957215788 3:77317802-77317824 CTGCTGGGGGGGCTGCTGGGGGG + Intronic
957215813 3:77317858-77317880 CTGCTGGGGGGGCTGCTGGGGGG + Intronic
958037531 3:88187936-88187958 GTGGGTGGAGGGCTGCGGGAGGG + Intergenic
960504768 3:118479271-118479293 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
960846200 3:122006484-122006506 CTGCCTGGGGGGGCACTGGAGGG + Intronic
960988733 3:123296926-123296948 CTGCATTGAGGGCTGCTGCCTGG - Intronic
961453111 3:127011396-127011418 CTGCCTTGGGGGCTGTTGCAGGG + Intronic
961469025 3:127099918-127099940 CTGCCTGGAGGGCAACTGTCAGG + Intergenic
961907742 3:130280137-130280159 CTGCTGTGAGTGCTGCTGGAAGG + Intergenic
963887626 3:150599588-150599610 CAGCCCTGAGGGCTGCTGGTTGG + Intronic
965176579 3:165343007-165343029 CAGCCTCAAGGGCTGCTGGTTGG - Intergenic
965556850 3:170027439-170027461 CAGCCCTGAGGGCTGCTGGTTGG + Intergenic
967593296 3:191302395-191302417 CAGCCCTGAGGGCTGCTGGTTGG - Intronic
967606112 3:191449265-191449287 CAGCCCTGAGGGCTGCTGGCTGG + Intergenic
968498622 4:932826-932848 CTGCCTGCCTGGCTGCTGGGAGG - Intronic
968904487 4:3445116-3445138 CTGCCTGGGAGGCTGCCCGAGGG + Intronic
968907768 4:3462591-3462613 CAGCTGGGAGGGCTGCTGGCAGG + Intergenic
969226155 4:5799703-5799725 CCCCTTGGAGGGCTCCTGGAAGG - Intronic
969462887 4:7338085-7338107 CTGGCTGGATGGATGTTGGATGG + Intronic
972320045 4:37965005-37965027 CTGCTTGGAGGGATGCTGACAGG + Intronic
972731871 4:41802724-41802746 AGCCCTGGAGGGCAGCTGGAGGG - Intergenic
972910559 4:43811034-43811056 CTGCCTGGAGGTTTGCTGTGTGG - Intergenic
974022162 4:56701334-56701356 CTGCCCTGAGGGCTGCTGGTTGG - Intergenic
979067453 4:116156420-116156442 CAGCCCCGAGGGCTGCTGGTTGG + Intergenic
979528444 4:121741913-121741935 CTAACTGGAGGGCTGCCAGAGGG + Intergenic
982094501 4:151909683-151909705 CTGCCTGGAGGGGTGAGGGAAGG - Intergenic
982485434 4:155959652-155959674 CTGCCTGGAAGAAGGCTGGACGG + Intergenic
982863951 4:160487640-160487662 CTGCCGCTAGGGCTGCTGGTTGG - Intergenic
983938829 4:173521704-173521726 CTCCCTGGAGGGCTGGGGGAAGG + Intergenic
984786089 4:183568460-183568482 TTGCAAGGTGGGCTGCTGGAAGG - Intergenic
984936881 4:184897524-184897546 CTGCCGGGAGGGCTGCAGGCCGG + Intergenic
985655626 5:1130169-1130191 CTGCCCGGGAGGCTGCTTGATGG - Intergenic
985942517 5:3150042-3150064 GGGCCTGGAGGGCTGGTGGCAGG + Intergenic
986737988 5:10681895-10681917 CTTCCTGCAGGGATGCTGGTGGG - Intronic
987310719 5:16678862-16678884 CTGCCTGCAGGACTGCTTGGAGG + Intronic
989385724 5:40853204-40853226 CTTCCTGGAGGGCAGCTTGAAGG - Exonic
990549417 5:56858846-56858868 CTGCCTGGGGTGCTGCAGGCTGG + Intronic
991083200 5:62623583-62623605 CAGCCCCGAGGGCTGCTGGCTGG + Intronic
991678519 5:69113775-69113797 GTGCTTGGAGTTCTGCTGGATGG - Intronic
993120237 5:83765834-83765856 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
993600275 5:89914486-89914508 CTGCCTTGAAGGCTCCAGGAGGG + Intergenic
994096697 5:95853680-95853702 GTGGCTGCAGGGCTTCTGGAGGG + Intronic
995110287 5:108421336-108421358 CAGCCTCGAAGGCTGCTGGTTGG + Intergenic
996233201 5:121091979-121092001 CTGACTTGAAGGGTGCTGGAGGG + Intergenic
996914508 5:128696007-128696029 CTGCCAGTAGGGGTGCTAGAGGG - Intronic
997824411 5:137093357-137093379 GTGCCAGGAAAGCTGCTGGATGG - Intronic
998015025 5:138725017-138725039 CTGACTGGAGGATTCCTGGAAGG - Intronic
998460653 5:142307676-142307698 CTGTCTGGAGAGCTGTAGGAGGG + Intergenic
999242618 5:150136535-150136557 CTGCCGGGCAGGCTGCTGGCTGG + Intronic
1001123362 5:168997705-168997727 CTGCTGGGAGGGGTCCTGGAAGG + Intronic
1001602024 5:172935093-172935115 CTTTCTGGAGGGTTGCTGGGGGG + Intronic
1003244645 6:4373667-4373689 CTGGCTGGAGTGCCTCTGGAGGG - Intergenic
1003607773 6:7580317-7580339 CTGCATGGTGAGCTGGTGGATGG - Exonic
1003959883 6:11199001-11199023 AGGCAAGGAGGGCTGCTGGATGG + Intronic
1004023021 6:11791386-11791408 CTGCCTGGACAGTTACTGGAGGG - Intronic
1004647068 6:17572552-17572574 ATGCAGGGCGGGCTGCTGGAGGG - Intergenic
1004734917 6:18395714-18395736 GTGCCTGGGGGGCTGCTGAGTGG + Intronic
1005209536 6:23444655-23444677 CTCCCTTGAGGGCTGCTGAAAGG - Intergenic
1005875525 6:30007520-30007542 CTACCTGGAGGGCACCTGCATGG + Intergenic
1006383680 6:33716606-33716628 CTGCCTGGAATGCAGCTGGGTGG + Intergenic
1008624098 6:53300887-53300909 CTGGCAGGAGGGCTGCAGGAAGG - Intronic
1008630842 6:53361681-53361703 TTGCCTGCAAGGATGCTGGAGGG + Intergenic
1011595089 6:89008484-89008506 CAGCCCCGAGGGCTGCTGGTTGG + Intergenic
1011754328 6:90483555-90483577 CTGGCTGGACTCCTGCTGGATGG + Intergenic
1012423984 6:99094430-99094452 CTGCCTGCAGGTGTGCTGGAAGG - Intergenic
1013585588 6:111575681-111575703 CTGGCTGGAGGGTTGCTAGGGGG + Exonic
1015548492 6:134386850-134386872 CGGGGTGGAGGGCTGCGGGAGGG + Intergenic
1015894087 6:137999527-137999549 CTCCCTGGAGGCCTCCTGCAGGG - Intergenic
1017177501 6:151518569-151518591 CAGCCTCGAGGGCTGCTGGCTGG + Intronic
1017610358 6:156179503-156179525 CAGCCCCGAGGGCTGCTGGTTGG + Intergenic
1017751208 6:157492083-157492105 CTGCCTGGAGGGCTGCTGGATGG - Intronic
1019149135 6:169992860-169992882 CCGCCTGGCCGGGTGCTGGAGGG - Intergenic
1019155844 6:170038384-170038406 CTGCCCTCAGGGCTGCTGGGGGG + Intergenic
1019165707 6:170096317-170096339 CTGCGCGGAGGGCGGCTGGGAGG - Intergenic
1019537381 7:1536350-1536372 GTTCCTCGGGGGCTGCTGGAGGG + Intronic
1020116210 7:5477953-5477975 GGGCCTGGAGGGCTTGTGGAGGG - Intronic
1021766583 7:23955942-23955964 CTGTATGGAAGGCTGCTGGAGGG + Intergenic
1023187890 7:37550319-37550341 CAGCCTTGAGGGCTGCTGGTTGG - Intergenic
1023862255 7:44223742-44223764 CTGGCTTGGGGGCTGCTGGAAGG - Intronic
1024322765 7:48087195-48087217 CAGCCTCTAGGGCTGCTGGTTGG - Intergenic
1024550995 7:50562278-50562300 GTCCCTGCACGGCTGCTGGAGGG - Intronic
1025085433 7:56019653-56019675 CTCCCTGGAGGGCTGGATGAGGG + Exonic
1025739020 7:64181893-64181915 CTGCCAAGCGGGGTGCTGGAGGG + Intronic
1026000395 7:66556427-66556449 CTGCCCCGTGGGATGCTGGAGGG + Intergenic
1026925336 7:74188368-74188390 CTGCCTGCAGGGCTTCCTGAAGG + Intronic
1028475507 7:91249113-91249135 CAGCCGGGAGAGCTGCTGGTGGG + Intergenic
1030347621 7:108452557-108452579 CTGCCAGGAAGGTTCCTGGAAGG + Intronic
1030921441 7:115393667-115393689 CTGCCCCTAGGGCTGCTGTAGGG + Intergenic
1031561929 7:123249098-123249120 GTGCCTGGAGGGCTTCCAGAAGG + Intergenic
1033596974 7:142865575-142865597 CTGCCTGGAGGGCTTCTACCGGG + Exonic
1034131487 7:148722503-148722525 CAGCCTGGAGGCCTGCAGGATGG - Intronic
1034197807 7:149261878-149261900 GAGCCGGGAGGGCTGCGGGAAGG - Intergenic
1034439735 7:151080649-151080671 CTGCGGGGAGGGCTGCGGGAGGG - Intronic
1035097226 7:156365462-156365484 CTGCCTGGAAGTCAGCTGCATGG + Intergenic
1035170786 7:157016350-157016372 CTGCCCTGCGGGCTGCTGGGTGG + Intergenic
1035636068 8:1145273-1145295 CTTCCTGGAGGGATGGTGGGTGG - Intergenic
1036460169 8:8945516-8945538 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
1037508067 8:19552444-19552466 CTGCATGCAGGTCTGTTGGAAGG - Intronic
1037928752 8:22865211-22865233 CAGCCTGGGGGGCGGCGGGAGGG + Intronic
1038472749 8:27838981-27839003 CAGCCTGGAGGGCTGCAGATGGG + Intergenic
1039446663 8:37638616-37638638 CTCCCTGTCTGGCTGCTGGATGG - Intergenic
1039844408 8:41315727-41315749 CTGCCGGGATGGCTGCGGGGAGG + Intergenic
1041200157 8:55446006-55446028 CTGTCTGAAGGGCTGATTGATGG + Intronic
1042669668 8:71247248-71247270 CCTCCTCTAGGGCTGCTGGAAGG - Intronic
1043755596 8:84000173-84000195 CTGCCACGAAGGCAGCTGGAGGG + Intergenic
1044259281 8:90098547-90098569 CACCCTAGAGGGCTGCAGGAAGG - Intergenic
1047431842 8:124799605-124799627 CTGCATGGCTGGCTTCTGGAAGG + Intergenic
1047716910 8:127603979-127604001 CTGCTCGGAAGGCTGCTGCACGG + Intergenic
1048188662 8:132267673-132267695 CTCCCTAGAAGGCTGCTGAAAGG + Intronic
1048863995 8:138745987-138746009 CTGCCTGCTTGCCTGCTGGAGGG - Intronic
1048960067 8:139569067-139569089 CTTCTTGGAGGGCTGCCTGAAGG - Intergenic
1049097890 8:140559562-140559584 ATGACTGTGGGGCTGCTGGACGG + Intronic
1049334138 8:142073515-142073537 CTGCCTGGAAGGCAGATGTAAGG + Intergenic
1049586701 8:143435716-143435738 GTGCCTGGAGGGGTGCCGGCTGG - Intergenic
1051583808 9:18706060-18706082 CAGCCCTGAGGGCTGCTGGTTGG + Intronic
1055348294 9:75359342-75359364 CAGCATGGAGGGCTGATGGTTGG + Intergenic
1056292740 9:85160354-85160376 CAGGCTTGAGGGCTGCTGCAGGG - Intergenic
1056292880 9:85161325-85161347 CAGGCTTGAGGGCTGCTGCAGGG - Intergenic
1056660472 9:88539400-88539422 CTCCTTGGAGGGCTGCTGGTGGG - Intronic
1056688373 9:88785144-88785166 ATACCTGCAGGGCTGGTGGATGG - Intergenic
1056752664 9:89363469-89363491 CTGCCTGGAGGGCTGTGGCTGGG - Intronic
1056790127 9:89619923-89619945 TTCCCTGCAGGGGTGCTGGAAGG + Intergenic
1056805912 9:89728822-89728844 CTGCCGGGAAGGCTGTAGGAGGG + Intergenic
1056923774 9:90814919-90814941 CCGCTTGGAGGGCTGCTGCAAGG - Intronic
1057310624 9:93940789-93940811 CTGCCTGGAGGGCAGCCAGCAGG + Intergenic
1057421415 9:94916002-94916024 AGGCCTGGAGGGCTGCTTTATGG - Intronic
1059673849 9:116517364-116517386 CAGCCTGGAGCTCTGCTGGGTGG + Intronic
1059856431 9:118403255-118403277 TTGCCTGGATGGATGATGGATGG + Intergenic
1060617927 9:125035914-125035936 CAGCCCCGAGGGCTGCTGGTTGG - Intronic
1060667281 9:125439452-125439474 CTGGCTGGTGGGAGGCTGGATGG - Intronic
1060852054 9:126886261-126886283 TGACCTGGAGGGCTGCTGGTGGG - Intergenic
1061847247 9:133394654-133394676 CCACCTGGAGGGCTGCTGCGAGG - Intronic
1061957217 9:133969962-133969984 CTGCCTTGAAGGCTGCAGGGAGG - Intronic
1061981010 9:134103645-134103667 CTGGATGGATGGATGCTGGATGG - Intergenic
1062280243 9:135748682-135748704 CTGCCTGGAAGGATCCTGGACGG - Intronic
1062547498 9:137070249-137070271 CTGCCCCGCGGGGTGCTGGAGGG - Exonic
1185663174 X:1743150-1743172 CAGCCCTGAGGGCTGCTGGTTGG + Intergenic
1185747492 X:2584289-2584311 CTGCCTGGGTGGCTGCTCGGCGG + Intergenic
1186590810 X:10928062-10928084 CTCCCAGCAGGGATGCTGGAAGG - Intergenic
1187960606 X:24563471-24563493 CTGCCTTGAGGGCTGATAGATGG + Intronic
1188126757 X:26377690-26377712 CAGCCCAGAGGGCTGCTGGTTGG - Intergenic
1190789574 X:53686424-53686446 CTGCGGGAAAGGCTGCTGGAGGG - Intronic
1191269463 X:58444880-58444902 TTGCATTGAGGGCTGCTGGCCGG - Intergenic
1193886557 X:86989056-86989078 CAGCCCCGAGGGCTGCTGGTCGG - Intergenic
1194348027 X:92790675-92790697 CTGCATGAGGGGCTGCTGGCTGG + Intergenic
1195068969 X:101261560-101261582 CAGCCTGGAAGGGTGTTGGATGG - Exonic
1195093815 X:101487610-101487632 CTGCCTGCATGTCTGCTGCAGGG + Intronic
1195206105 X:102601466-102601488 CTGCCTGTAGATCTGCTGTAGGG + Exonic
1196934871 X:120719641-120719663 CTGGATGGAGAGCTGCTGGCAGG - Intergenic
1197268898 X:124404696-124404718 ATGCTGGGAGGGGTGCTGGAGGG + Intronic
1197739043 X:129875223-129875245 CAGCCCTGAGGGCTGCTGGTTGG - Intergenic
1198376234 X:136042600-136042622 CTGCCTCGAGGACTGCAGGTAGG - Intronic
1200062918 X:153491584-153491606 CGCCCAGGACGGCTGCTGGAAGG - Intronic
1200394417 X:155975097-155975119 CTGGCTGAAGGGCTACTGGATGG - Intergenic
1200656355 Y:5907305-5907327 CTGCATGAGGGGCTGCTGGCTGG + Intergenic
1200814313 Y:7516062-7516084 CAGCCCCGAGGGCTGCTGGTTGG + Intergenic
1201226545 Y:11824275-11824297 CTGCCTTGTGGGCTACTAGATGG - Intergenic
1201357494 Y:13112785-13112807 CTGCCTAGAGGGATACTGCAAGG + Intergenic