ID: 1017751516

View in Genome Browser
Species Human (GRCh38)
Location 6:157493564-157493586
Sequence CTCTCACAGCAGTGGGCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017751516_1017751525 20 Left 1017751516 6:157493564-157493586 CCACAGGCCCACTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1017751525 6:157493607-157493629 CCACATCCGTGACAGTGGGATGG 0: 1
1: 0
2: 0
3: 12
4: 107
1017751516_1017751523 16 Left 1017751516 6:157493564-157493586 CCACAGGCCCACTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1017751523 6:157493603-157493625 TGAGCCACATCCGTGACAGTGGG No data
1017751516_1017751522 15 Left 1017751516 6:157493564-157493586 CCACAGGCCCACTGCTGTGAGAG 0: 1
1: 0
2: 0
3: 19
4: 279
Right 1017751522 6:157493602-157493624 ATGAGCCACATCCGTGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017751516 Original CRISPR CTCTCACAGCAGTGGGCCTG TGG (reversed) Intronic
900106582 1:984046-984068 CTGTCACTGGAGTTGGCCTGAGG + Intergenic
900420494 1:2554039-2554061 CTGGCACAGCATTGGGTCTGGGG + Intergenic
901534741 1:9874858-9874880 CTTTCAAAGTAGTGGGCCTTGGG + Intronic
901541102 1:9917129-9917151 CTATCACAGAAGGGAGCCTGTGG - Intergenic
903172385 1:21562478-21562500 CTCCCCCAGAAGTGAGCCTGGGG - Intronic
903211472 1:21821718-21821740 CCCTCAGAGCTGGGGGCCTGTGG - Intronic
903335208 1:22619959-22619981 CTGTCACATCAAAGGGCCTGGGG - Intergenic
903389651 1:22954874-22954896 CTCTGGGAGCAGTGGGGCTGTGG - Intronic
904470613 1:30733794-30733816 CCCTCCCAGCACTGGGGCTGGGG + Exonic
904612155 1:31731685-31731707 CTTTGACAGCCGTGGGGCTGTGG - Intronic
905276925 1:36824444-36824466 CTCTGGCAGCACAGGGCCTGGGG + Intronic
907803892 1:57799257-57799279 CATTCACAGCTGTGGGGCTGAGG - Intronic
911575833 1:99576947-99576969 CTCTCTCAGCATTGGGACTAGGG - Intergenic
912496218 1:110093809-110093831 TTGTCACAGCGCTGGGCCTGTGG + Intergenic
912654942 1:111477675-111477697 CCATCTCAGCAATGGGCCTGGGG - Exonic
913601012 1:120421157-120421179 CTCTGGCAACAGTGGGCCAGAGG + Intergenic
914086043 1:144455476-144455498 CTCTGGCAACAGTGGGCCAGAGG - Intronic
914191936 1:145419427-145419449 CTCTGGCAACAGTGGGCCAGAGG - Intergenic
916983727 1:170167604-170167626 CTCTGACAGCAGTGTGACTCGGG + Exonic
917334774 1:173915872-173915894 CACTCACAGGAGCAGGCCTGTGG - Intronic
919927422 1:202199477-202199499 CTCTGGCAGCAGCGGGCATGGGG + Intronic
920930881 1:210386756-210386778 CTCTGACAACAGTGGACATGTGG - Intronic
922829166 1:228542500-228542522 CTCTCCCAGTAGAGTGCCTGTGG + Intergenic
923171069 1:231418022-231418044 CTTTCACAGCAGTAGGCAGGTGG - Intronic
923234651 1:232020899-232020921 CTCTCAAACCAGTGGGCTTTAGG - Intronic
924798722 1:247311640-247311662 CTCCCAACACAGTGGGCCTGGGG - Intronic
1062867128 10:865223-865245 CTCTCAGATCACTGGGGCTGAGG + Intronic
1063141986 10:3263824-3263846 CTCTCACTGCTGCCGGCCTGGGG - Intergenic
1063591199 10:7397190-7397212 CTTCCTCAGCAGTGAGCCTGGGG - Intronic
1063917232 10:10895870-10895892 CTCTCAAAGCAGTAAGCTTGGGG - Intergenic
1064104494 10:12489786-12489808 CTCTCACAGAAGTTTGCCTGAGG + Intronic
1064458755 10:15512788-15512810 CTCCCACAGCAGTGGGATTAAGG + Intergenic
1065708053 10:28489307-28489329 CTCCCACAGCTCTGGGACTGAGG - Intergenic
1065977735 10:30858066-30858088 CACTCTTAGCAGTAGGCCTGTGG - Intronic
1067239051 10:44475031-44475053 CCCTGACGCCAGTGGGCCTGAGG + Intergenic
1067716125 10:48692273-48692295 CTCACACACCTGTGGGCCTGTGG + Intronic
1068092353 10:52448230-52448252 CTCTCACAGCAGTGTGATTTTGG + Intergenic
1069718745 10:70537051-70537073 CCCTCACAGCAGTGCTCCAGGGG - Intronic
1074317002 10:112369895-112369917 CTCTCACTGCCGGGGGCCAGCGG - Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075728256 10:124621538-124621560 CTCTCAGGGCTGTGGGGCTGGGG + Exonic
1077021307 11:418291-418313 CACGCACAGCGGTGGGCTTGTGG + Exonic
1077251745 11:1563793-1563815 CTCCGCCAGCAGTGGGGCTGGGG - Intronic
1081047701 11:38296520-38296542 CCCTCACTGCCCTGGGCCTGCGG + Intergenic
1084577256 11:69997429-69997451 CTCTCAGAGCCATGGTCCTGGGG - Intergenic
1084608420 11:70185860-70185882 CTGTCAGTGCAGGGGGCCTGGGG - Intronic
1085265595 11:75236242-75236264 GTCTCACAGCAGTGGGGGAGGGG + Intergenic
1086984959 11:93237731-93237753 ATTTCACAGAAGAGGGCCTGAGG + Intergenic
1087011889 11:93522385-93522407 CTTTCTCAGCAGAGGGGCTGTGG + Intronic
1088184356 11:107148737-107148759 CTCACTCTGCAGTGGGACTGAGG - Intergenic
1088815239 11:113416351-113416373 CTCCCACAGAAATGGGCATGTGG + Intronic
1089387772 11:118079333-118079355 CTGTCACAGAAAGGGGCCTGTGG - Intronic
1089498522 11:118919629-118919651 CTCTCACTGCACTGGGCGGGGGG + Intronic
1089614852 11:119689490-119689512 CTCCCACAGCAGAGTGCCTCTGG - Intronic
1091917123 12:4277702-4277724 GTCCCACAGCTGTGGGGCTGGGG - Intronic
1091991618 12:4960444-4960466 CTTGGGCAGCAGTGGGCCTGGGG - Intergenic
1092152763 12:6262434-6262456 CTCCCACAGGAGTGGGAATGGGG - Intergenic
1092562014 12:9625459-9625481 TTGCCACAGCAATGGGCCTGTGG + Intergenic
1096162066 12:49387115-49387137 CTCTCATACCACTGGACCTGGGG - Exonic
1099201204 12:79679196-79679218 ATCACACAGCACTGAGCCTGGGG + Intronic
1100813227 12:98360950-98360972 CTCTCTCTGCAGAGGCCCTGGGG + Intergenic
1102021310 12:109685233-109685255 CTCTCACATCAGAGGGAGTGAGG + Intergenic
1102224994 12:111222393-111222415 ATCTCCCAACAGTGGCCCTGTGG - Intronic
1102254441 12:111407426-111407448 CTGCCAGGGCAGTGGGCCTGTGG + Intronic
1102482456 12:113233164-113233186 ATCTCATGGCAGGGGGCCTGAGG - Intronic
1103526103 12:121569679-121569701 CGCTGACTGCAGTTGGCCTGGGG - Intronic
1104775378 12:131387540-131387562 CTCTTAGAGCAGTGGGAGTGGGG - Intergenic
1105259169 13:18766218-18766240 CTACCAGGGCAGTGGGCCTGTGG - Intergenic
1105261848 13:18785537-18785559 CTACCAGGGCAGTGGGCCTGTGG - Intergenic
1105264205 13:18802126-18802148 CTACCAGGGCAGTGGGCCTGTGG - Intergenic
1107984465 13:45763456-45763478 CTCATTCAGCAGTGGGCCTGGGG - Intergenic
1111412234 13:87892135-87892157 CTATCACAGCAGTTGGACAGTGG + Intergenic
1111507598 13:89214611-89214633 CTCTCACAGCAGAGACCATGTGG - Intergenic
1112669162 13:101614771-101614793 ATCTCCCAGCATTGGTCCTGAGG - Intronic
1115457153 14:33616643-33616665 CTCTCAGCGCAGAGGGGCTGAGG + Intronic
1115516749 14:34192794-34192816 CTGTCACAGCAGTGTGTTTGGGG - Intronic
1119014083 14:71031323-71031345 CTGTCCCAGCACTTGGCCTGGGG - Intronic
1120248487 14:82033333-82033355 CTCTCACAGTTCTGGGCATGGGG - Intergenic
1121399727 14:93663262-93663284 CTTTCTCAGTAGTGGGCCAGGGG - Intronic
1121674447 14:95741061-95741083 TGCTCACAGCAGAGGCCCTGAGG + Intergenic
1122540197 14:102493731-102493753 CTGTCACAGCAGGGAGGCTGGGG - Intronic
1123151404 14:106185257-106185279 CTCTCTCAGCCCTGGGACTGGGG + Intergenic
1124884602 15:33673272-33673294 TGCTCACAGCAGAGGGACTGCGG - Intronic
1126116724 15:45215005-45215027 TGCTCAGAGCAGGGGGCCTGAGG - Intergenic
1127051580 15:55089485-55089507 CTTTCAGTGCAGTGGTCCTGAGG + Intergenic
1128360358 15:66957426-66957448 CTGTGACACCAGTGGGCCTCAGG + Intergenic
1129166405 15:73780720-73780742 CTCTCACAGCTAGGGGGCTGAGG - Intergenic
1130402921 15:83574065-83574087 CTCTCACAGCCCTGGCCCTCTGG - Intronic
1131285523 15:91053798-91053820 GTCACATGGCAGTGGGCCTGGGG - Intergenic
1131462123 15:92624811-92624833 TTCTCCCAGCAGTGTGCCTTTGG + Intronic
1132195708 15:99913301-99913323 CTCCCACAGCTGTCGGCCTTAGG - Intergenic
1132616556 16:843796-843818 CTCTCGAAGCCGTGGGGCTGGGG + Intergenic
1132645029 16:995004-995026 CTCTCACAGCTGTGGGTCCCAGG + Intergenic
1133026180 16:2989880-2989902 CTATCCAAGCAGTGGGCCTGTGG - Intergenic
1133034439 16:3027114-3027136 CCCTGTCAGCTGTGGGCCTGTGG + Intronic
1133255610 16:4514071-4514093 CTCTTCCAGAAGTGGGGCTGTGG + Exonic
1134022850 16:10933425-10933447 ATCTCACAGCATTTGCCCTGAGG - Intronic
1134071620 16:11263672-11263694 CTGTCACTCCTGTGGGCCTGAGG - Intronic
1134072894 16:11271818-11271840 CTCTCCCAGCAGCGGGTGTGCGG + Intronic
1136462543 16:30420646-30420668 AACTCATAGCAGTGGACCTGGGG + Intronic
1137994394 16:53194109-53194131 CTCTCACAGCACTGGGATTACGG - Intronic
1139690402 16:68638112-68638134 CTCTCTCTGCAGGGGGCTTGGGG + Intronic
1140475137 16:75235927-75235949 CTCACGCAGCAGTGGGCCATCGG + Exonic
1141248056 16:82329258-82329280 CTCTCACAGCGGGTGGCCAGAGG - Intergenic
1142416976 16:89948597-89948619 CTCTCATCGCAGAAGGCCTGTGG - Intronic
1143334263 17:6160469-6160491 CTGTCACAGCTGTGAGCCTGAGG - Intergenic
1143399828 17:6637034-6637056 ATCTCACACCTGTGTGCCTGGGG - Intronic
1144777984 17:17794423-17794445 CTCTGACAGCGGTGTGCCTGCGG - Exonic
1145865726 17:28240450-28240472 ATTTCACAGAAGTGGGGCTGTGG - Intergenic
1146837425 17:36123444-36123466 ATTCCACATCAGTGGGCCTGAGG + Intergenic
1147625431 17:41896930-41896952 CTGTCCCTGCAGAGGGCCTGGGG - Intronic
1147647201 17:42040851-42040873 CTCTGCCAGCAGTGGGCAAGTGG + Intronic
1148068462 17:44891292-44891314 CTCTCACAGCAATGACACTGAGG + Intronic
1148090017 17:45017926-45017948 CTCTCAAAGCACTAAGCCTGAGG + Intergenic
1149696317 17:58619114-58619136 CTCTAGCAGCAGTGGAACTGGGG + Intronic
1149772619 17:59332771-59332793 CTTTCACAGCGGCGGGACTGGGG - Intronic
1149775075 17:59350947-59350969 CTCTAGCAGCATTTGGCCTGGGG + Intronic
1150636396 17:66916231-66916253 CTCTCCCGGAGGTGGGCCTGAGG - Intergenic
1151945215 17:77315968-77315990 TTCCCAAAGCCGTGGGCCTGAGG + Intronic
1152695327 17:81741176-81741198 CCCTCACAGCCCCGGGCCTGAGG + Intergenic
1152988419 18:340409-340431 CTCCCAGAACCGTGGGCCTGGGG - Intronic
1153356723 18:4144466-4144488 GTCTCCCAGCAGGGGCCCTGTGG - Intronic
1156519495 18:37709971-37709993 CACTCACCGCAGTAGGCTTGGGG + Intergenic
1158244206 18:55412469-55412491 CTTTCAGAGCAGCGGGCCAGTGG - Intronic
1158582059 18:58692200-58692222 CTCCCACTGAAGAGGGCCTGGGG + Intronic
1160890151 19:1373480-1373502 CTCACACAGCCATGGGGCTGTGG - Intronic
1161331163 19:3688391-3688413 CGCCCACAGCAGGGGGCCAGAGG - Intronic
1162565569 19:11444449-11444471 GTCTCACAGATGAGGGCCTGAGG - Intronic
1162796630 19:13090609-13090631 CTCTGACAGCCCTGGCCCTGGGG + Intronic
1164383307 19:27753354-27753376 CTCTCACATTAGAAGGCCTGGGG + Intergenic
1164534626 19:29076050-29076072 CTCTGGCAGCAGCTGGCCTGTGG + Intergenic
1165291412 19:34889145-34889167 CTCTCACAACAGTGGCAATGGGG - Intergenic
1166380093 19:42351210-42351232 CACTCACAGAAGGGGTCCTGGGG - Exonic
1167699430 19:51033818-51033840 CTTCCTTAGCAGTGGGCCTGGGG - Intronic
925258783 2:2511926-2511948 CTCTGAGAGCAGAGGGGCTGTGG + Intergenic
926244725 2:11114152-11114174 CTCTCCCACCTTTGGGCCTGCGG - Intergenic
927229160 2:20802982-20803004 ATCTCACAGCAGTGGAACAGTGG - Intronic
927243052 2:20935397-20935419 CTCTCTGAGCAATAGGCCTGTGG - Intergenic
928067144 2:28175844-28175866 CTCTGGCAGCAGTGGGCCAAGGG - Intronic
928415899 2:31091492-31091514 CTTTCACAGGAGTGGCCTTGGGG - Intronic
929790335 2:45017810-45017832 CTTTCCCAGCTGTGGGGCTGAGG - Intergenic
931911125 2:66901465-66901487 CTCTCTGACCAGTGGGCTTGTGG + Intergenic
932476493 2:72009557-72009579 CACTCACAGCCGTGTGCCTCTGG - Intergenic
934031020 2:88046929-88046951 CTCCCAAAGCAGTGGGACTATGG + Intronic
934762637 2:96864934-96864956 GTCTCACAGCGGTGGGCCCTGGG - Intronic
934912702 2:98274226-98274248 CTCTCACAGCAGTGATGCTCTGG - Intronic
935583828 2:104783289-104783311 CTCTCCCAGCAGTGAGCAGGAGG - Intergenic
935695017 2:105763613-105763635 CTGTTACAGCAGTGGGGTTGGGG + Intronic
937247269 2:120501817-120501839 CTCCCTCCGCTGTGGGCCTGGGG - Intergenic
938115785 2:128602244-128602266 CTCTCACAGCAGCGAGGCTGAGG + Intergenic
938948282 2:136234410-136234432 CCCTCACAACAGTGTGTCTGGGG - Intergenic
940518557 2:154713400-154713422 CATTCACAGCAGTGTGCCGGTGG + Intronic
941421094 2:165283629-165283651 GTCTAATAGCAGTGGACCTGTGG + Intronic
942138750 2:172956090-172956112 CCCTCTCAGCAGTGGCCCCGAGG + Intronic
942905024 2:181169777-181169799 CTCTCCCAGCAGTCAGCCTGAGG + Intergenic
946199971 2:218065687-218065709 TGCTCCCAGCAGTGGCCCTGGGG - Intronic
946952259 2:224889849-224889871 CTCTCACAGGAGTGGGGGAGAGG - Intronic
947905474 2:233758426-233758448 CTCACACAGCATTGGGACTTTGG + Intronic
947929600 2:233952703-233952725 CTCTGGCAGCAGTGGGGCAGAGG + Intronic
948091738 2:235301527-235301549 CTCTCACGGCAGCTGTCCTGGGG + Intergenic
948663297 2:239519867-239519889 TCCTCACCGCAATGGGCCTGGGG - Intergenic
948861558 2:240755093-240755115 TTCCAACAGGAGTGGGCCTGGGG - Intronic
949067673 2:242003233-242003255 CTCACACATCTGAGGGCCTGGGG + Intergenic
1168736734 20:146615-146637 CTATCAGGGAAGTGGGCCTGAGG - Intergenic
1169269356 20:4187387-4187409 CTCTTCCAGCAGGGGACCTGAGG + Exonic
1169297639 20:4413685-4413707 CTCTCAGAGCAATGAGCCCGAGG + Intergenic
1170572092 20:17638174-17638196 GTCTGCCAGCAGTGGGCCGGTGG - Intronic
1172437430 20:34939331-34939353 CTCTCAAAGCATAGGGCCTGTGG - Intronic
1172633523 20:36394299-36394321 CTATCACAGAACAGGGCCTGAGG + Intronic
1173124428 20:40323648-40323670 CACACACAGCAGTGGCCCTTAGG - Intergenic
1173132361 20:40406455-40406477 CACTCACAGAACTGGCCCTGGGG + Intergenic
1174039184 20:47687026-47687048 CTCTCAGAGCAGCGAGCGTGTGG + Intronic
1175150749 20:56931994-56932016 CTCCAACAGCACTGGGACTGGGG + Intergenic
1175933102 20:62502634-62502656 CCCACAGAGCAGTGGGCCTTGGG + Intergenic
1176114905 20:63427964-63427986 CTCTGACAGCCGTGGGCTTTGGG + Intronic
1180138769 21:45878210-45878232 CTCTCCCACCAGAGGACCTGTGG + Intronic
1183542179 22:38435865-38435887 CTCAAAGAGCCGTGGGCCTGGGG - Intronic
1183587429 22:38760979-38761001 TTCTCACAGCAGTGTTGCTGTGG + Intronic
1183605563 22:38865326-38865348 CTCTCGCCTCAGTAGGCCTGGGG - Exonic
1183779471 22:39989523-39989545 CTCTCCTCCCAGTGGGCCTGGGG + Intergenic
1185274504 22:49944502-49944524 CTCTCACACTGCTGGGCCTGGGG + Intergenic
949332211 3:2935066-2935088 CTCCCAGAGGACTGGGCCTGTGG - Intronic
949472645 3:4412969-4412991 CTCTCAAATCAGTCTGCCTGAGG + Intronic
949628154 3:5891339-5891361 CTCTTACAGCTGTGGGACTAGGG + Intergenic
950498288 3:13347552-13347574 CTCACGCAGCAGGGGTCCTGTGG - Intronic
950709157 3:14802740-14802762 ATCTCACCTCACTGGGCCTGGGG + Intergenic
951718837 3:25676917-25676939 CACTTACAGCAGTGGGACTTTGG - Intergenic
952220009 3:31315644-31315666 CTCTCAGACCTCTGGGCCTGTGG - Intergenic
952931523 3:38364538-38364560 CATTCTAAGCAGTGGGCCTGAGG - Intronic
954542073 3:51400229-51400251 CTCTTACAGCAGAGGAGCTGAGG - Intronic
956974045 3:74559503-74559525 CTCTACCAGCAGGGAGCCTGTGG + Intergenic
958923824 3:100136337-100136359 CACTCAAAGCTGTGGGCGTGTGG - Intronic
959508255 3:107178361-107178383 CTCTCCCATCACAGGGCCTGGGG - Intergenic
961658772 3:128457415-128457437 CTCCCTCTGCACTGGGCCTGGGG - Intergenic
961763764 3:129191754-129191776 CTCTAAAAGCAGTGTGCCTAGGG - Intergenic
962278819 3:134035141-134035163 CTCTCAAAGCACTGGGATTGCGG + Intronic
962372587 3:134833284-134833306 CCATCAAAGCAGAGGGCCTGGGG - Intronic
962471887 3:135716363-135716385 CTCACACAACAGTGGGCTGGAGG - Intergenic
962646386 3:137444954-137444976 TTCTCACAGCAGTGCCCCAGTGG + Intergenic
962962460 3:140323183-140323205 TTCCCACAGCAGTGGGCTTCCGG + Intronic
962962649 3:140325309-140325331 TTCCCACAGCAGTGGGCTTCCGG + Intronic
962968821 3:140380170-140380192 CTCTGACAACACTGGGCTTGAGG + Intronic
964824440 3:160809590-160809612 CTTTGATAGCAGTGGGCCTTGGG + Intronic
965092542 3:164181438-164181460 TTCTCACAGCACTGACCCTGTGG + Intergenic
965770924 3:172180353-172180375 CTCAAACAGTAGTGAGCCTGGGG - Intronic
967187746 3:186959960-186959982 CTGTCACAGCAGTAAGGCTGTGG - Intronic
967870979 3:194228875-194228897 CTTTCACAGCTGTGTGCCTGGGG - Intergenic
968054912 3:195684013-195684035 CTCTGACAGCAGTCGGGCTTCGG + Intergenic
968100999 3:195965259-195965281 CTCTGACAGCAGTTGGGCTTCGG - Intergenic
968726523 4:2250436-2250458 ATGGCACAGCAGTGGGCCTGTGG + Exonic
968772290 4:2515039-2515061 CCCTGACAGCACAGGGCCTGGGG + Exonic
969490454 4:7496486-7496508 ATCTCAGGGCAGTGAGCCTGTGG + Intronic
969585451 4:8088712-8088734 CTATCACAGTAGTGGGCCCTGGG - Intronic
970313452 4:14806955-14806977 CACTCAAAGCAGAGAGCCTGAGG - Intergenic
970726519 4:19051893-19051915 TCCTTACAGCAGTTGGCCTGGGG + Intergenic
973741731 4:53925411-53925433 CCCTCACAGCAGTGTGGGTGGGG - Intronic
974910329 4:68109999-68110021 TTCTCACAGCAGTAGCCTTGGGG + Intronic
977572479 4:98643878-98643900 TTCTCACAGGAGTTGCCCTGTGG + Intronic
978595700 4:110374653-110374675 CTCTCTCAGGAGTCGGCCTCTGG - Intronic
984875635 4:184365082-184365104 CTGTCACAGAAGTGGGAGTGGGG + Intergenic
985579287 5:688620-688642 CCCTCCCAGCAGGCGGCCTGGGG + Intronic
985594131 5:780679-780701 CCCTCCCAGCAGGCGGCCTGGGG + Intergenic
985734932 5:1574012-1574034 CTCTGACAGCAGTTGGGCTTTGG - Intergenic
986610075 5:9558456-9558478 CTTTCACAGCTGTGTGCATGGGG + Intergenic
986970705 5:13332803-13332825 CTCTCCCAACAAGGGGCCTGAGG + Intergenic
992433678 5:76734367-76734389 GCCTCACAGCAGTGAGACTGGGG + Exonic
998043336 5:138967422-138967444 CTCTCACCCTGGTGGGCCTGAGG + Intronic
998723344 5:144979062-144979084 CTCTAACAACAGTGAGCATGGGG - Intergenic
1002133366 5:177094544-177094566 CTCCTACAGCAGTGGACGTGGGG - Intronic
1002176110 5:177402430-177402452 CTCACACACCAGCGGGCCTCCGG + Exonic
1002241533 5:177845704-177845726 CTCTCAGGCCAGTGGGCATGAGG - Intergenic
1004512964 6:16297545-16297567 CTCTGATAGGAGTGGGGCTGGGG + Intergenic
1006410946 6:33872909-33872931 CTCGGAAAGCAGTGGGGCTGGGG - Intergenic
1010020451 6:71153962-71153984 CCCTCAGATCAGTGAGCCTGTGG + Intergenic
1010528776 6:76941316-76941338 CTACCCCAGCAGTGGCCCTGTGG + Intergenic
1011300004 6:85863920-85863942 CTTTAACAGCAGTGGGAGTGGGG + Intergenic
1012310045 6:97712437-97712459 CTGTCACAGCAGAGGCCATGGGG + Intergenic
1012451107 6:99353048-99353070 GTCTTACACCAGTGGCCCTGTGG + Intergenic
1012968042 6:105696796-105696818 CTCTCACATCAGTGGCCATGTGG + Intergenic
1015429118 6:133109683-133109705 CTCTCTGAGCAGTGGGCTAGAGG + Intergenic
1015708686 6:136115833-136115855 CTCAGACAGCAGTGGGACTGGGG + Intronic
1015806743 6:137117688-137117710 CTCTGAAAGCAGTGGTCATGTGG - Intergenic
1016890241 6:148998906-148998928 CACTCACAGCAGTCAGCCAGTGG + Intronic
1017751516 6:157493564-157493586 CTCTCACAGCAGTGGGCCTGTGG - Intronic
1018900455 6:168049368-168049390 CTCTCACAGACGTGGACCTTTGG + Intergenic
1019085263 6:169469459-169469481 CTGCCACCCCAGTGGGCCTGAGG - Intronic
1019262496 7:89398-89420 CCCTGACAGAAGTGGGGCTGTGG - Intergenic
1019389948 7:780715-780737 CACTCACAGCACAGGGCCTGAGG + Intronic
1019514248 7:1432803-1432825 CTAACACAGCAGAGGCCCTGGGG + Intronic
1019636087 7:2076455-2076477 TTCTCACAGCTGTGGAGCTGAGG - Intronic
1020017910 7:4842253-4842275 CTCTCACAGCAGAGGCCGTAAGG + Intronic
1021510236 7:21426981-21427003 GACTCAAAGCAGGGGGCCTGAGG + Intergenic
1022533226 7:31079792-31079814 CTCTCCCATCTGAGGGCCTGGGG + Intronic
1023838144 7:44080351-44080373 CTCTGACAGGTGTGGGCTTGGGG - Intronic
1024210122 7:47195958-47195980 CACTGACAGCAAGGGGCCTGGGG - Intergenic
1024569185 7:50709986-50710008 CTCTCACAGCACTCGGCCCTGGG + Intronic
1026193018 7:68146830-68146852 GTCTCATGGCAGTGGTCCTGAGG - Intergenic
1028724862 7:94075544-94075566 CAGTCATAGCAGTGGGCATGTGG + Intergenic
1032498601 7:132381913-132381935 CTCTCACATCAGGAAGCCTGCGG - Intronic
1032671460 7:134086599-134086621 CTCTCAAGGCAGTGGTTCTGGGG + Intergenic
1034737751 7:153444963-153444985 CTCGCACAGCAGGGGAGCTGAGG - Intergenic
1034881755 7:154768043-154768065 CTCTAAGGGCAGTGGGGCTGAGG - Intronic
1035284864 7:157799610-157799632 CGCTCAGAACACTGGGCCTGAGG - Intronic
1036781325 8:11649920-11649942 CTCTCACACCTCTGGGCCTCTGG - Intergenic
1037889782 8:22617833-22617855 TTCTCCCAGGAGTGGGCCAGAGG - Intronic
1042752249 8:72170695-72170717 CTCACAAAGCAGTGGGGGTGTGG + Intergenic
1042900687 8:73724111-73724133 CTCTCAGTGCAGTAGGCCTGGGG + Intronic
1044989923 8:97786821-97786843 GACTAACAGTAGTGGGCCTGGGG + Intronic
1047184286 8:122617844-122617866 CTCTGCCAGCAGAGGGCCTTTGG + Intergenic
1048598824 8:135896798-135896820 CTCTCAGAGCTGTGGGGCTTGGG - Intergenic
1049207615 8:141370766-141370788 CCCTCACTGCTGTGGGCCTTGGG - Intergenic
1049985581 9:947909-947931 TTCTCCCAACAGTGGGCCTGGGG + Intronic
1051562025 9:18452880-18452902 CTGTCAGAGCTGTAGGCCTGGGG - Intergenic
1055668757 9:78579118-78579140 GTCTCACTGCAGTAGGCATGGGG + Intergenic
1056578081 9:87870893-87870915 CCCACTCAGCCGTGGGCCTGCGG - Intergenic
1057231778 9:93325611-93325633 CTCTCACAGCTGTGTTCCTTGGG - Intronic
1060012309 9:120054653-120054675 CTCTCAGAAGAGTGGGGCTGAGG + Intergenic
1060657352 9:125381059-125381081 CTGTCACAGCAGAGGGTCTGTGG + Intergenic
1060884351 9:127140093-127140115 TTATCACAGCAGTGAGACTGTGG + Intronic
1061534390 9:131238699-131238721 CTGCCACCTCAGTGGGCCTGTGG - Intergenic
1061654535 9:132079066-132079088 CTCCCACAGGAGTGGGAGTGAGG + Intronic
1062502095 9:136856026-136856048 CTGTCTCTGCAGCGGGCCTGGGG + Exonic
1062585604 9:137248061-137248083 CTGTCAGAGGAGGGGGCCTGGGG - Intergenic
1185853799 X:3513460-3513482 CTCAGACAGAAGTTGGCCTGTGG + Intergenic
1186746634 X:12576557-12576579 TTCTCACAGAAGAGTGCCTGAGG - Intronic
1187027592 X:15452097-15452119 CTCTAACCCCAGTGGGGCTGAGG + Intronic
1189194545 X:39141485-39141507 TCCACACAGCATTGGGCCTGTGG - Intergenic
1189578049 X:42376044-42376066 ATCTCACAGCAGTGCTCCTGAGG + Intergenic
1189687205 X:43576889-43576911 TTCTCAGAGCAGTGTGCTTGTGG + Intergenic
1189723922 X:43949781-43949803 CACACACAGCAGCGGGCCTCAGG + Exonic
1193329918 X:80224188-80224210 ATCTCAGAGCAGTGGGCTTGTGG - Intergenic
1195613561 X:106895204-106895226 CTCTCACAGCACCTGGGCTGTGG - Intronic
1196641579 X:118068705-118068727 CTCTCAGTGCAGTAGCCCTGTGG - Intronic
1197723669 X:129761562-129761584 CTCCCAAAGCAGTGGGACTATGG - Intronic
1197904643 X:131412172-131412194 CTCTAACAGCACTCGGGCTGGGG + Intergenic
1198196836 X:134372012-134372034 CTTTCACAGCATAGGGCCTTGGG + Intergenic
1200809658 Y:7471064-7471086 CTCAGACAGAAGTTGGCCTGTGG - Intergenic
1202181371 Y:22142699-22142721 CTTTCACAGCTGTCAGCCTGTGG + Intergenic
1202209989 Y:22443701-22443723 CTTTCACAGCTGTCAGCCTGTGG - Intergenic