ID: 1017753954

View in Genome Browser
Species Human (GRCh38)
Location 6:157514012-157514034
Sequence CCTTTCTCTCGGAGGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017753942_1017753954 19 Left 1017753942 6:157513970-157513992 CCCTGGTCCCAGGCTCTTCCCAC 0: 1
1: 1
2: 3
3: 51
4: 409
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1017753943_1017753954 18 Left 1017753943 6:157513971-157513993 CCTGGTCCCAGGCTCTTCCCACT 0: 1
1: 0
2: 3
3: 49
4: 505
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1017753941_1017753954 27 Left 1017753941 6:157513962-157513984 CCTTCAGACCCTGGTCCCAGGCT 0: 1
1: 0
2: 2
3: 43
4: 360
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1017753946_1017753954 1 Left 1017753946 6:157513988-157514010 CCCACTGTGACACGCCATCCACA 0: 1
1: 0
2: 0
3: 5
4: 108
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1017753944_1017753954 12 Left 1017753944 6:157513977-157513999 CCCAGGCTCTTCCCACTGTGACA 0: 1
1: 1
2: 2
3: 32
4: 299
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1017753945_1017753954 11 Left 1017753945 6:157513978-157514000 CCAGGCTCTTCCCACTGTGACAC 0: 1
1: 0
2: 5
3: 28
4: 294
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166
1017753947_1017753954 0 Left 1017753947 6:157513989-157514011 CCACTGTGACACGCCATCCACAT 0: 1
1: 0
2: 1
3: 12
4: 156
Right 1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017753954 Original CRISPR CCTTTCTCTCGGAGGCTGGC TGG Intronic
900315856 1:2056018-2056040 CCTTTCTCCCAGGGACTGGCGGG + Intronic
902076406 1:13790333-13790355 CCGTTCTTTCTAAGGCTGGCGGG + Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903292939 1:22326162-22326184 CCTTTCTCTCTGTAGCAGGCTGG - Intergenic
903391327 1:22965417-22965439 CCTTGCTCTCCCAGGATGGCTGG - Intergenic
904538357 1:31216103-31216125 CCTCTATCTCGCAGGCAGGCTGG + Intronic
905548544 1:38818305-38818327 CCTTGGTCTCCGAGGCGGGCGGG - Intergenic
913317116 1:117562839-117562861 CCTTTCTCTCTGCAGCTGCCAGG + Intergenic
916259742 1:162829638-162829660 ACTCTCTCACCGAGGCTGGCTGG + Intronic
918429871 1:184448407-184448429 CCCTTCTCTCTGAGGCTTGCTGG + Intronic
920303577 1:205004531-205004553 CACTTCTCTCACAGGCTGGCTGG + Intronic
920630583 1:207647664-207647686 CCTTCCTCTTGGAGGCAGGAGGG - Intronic
920819460 1:209366824-209366846 CCTTTCTCTAAGAGGCAGGGTGG - Intergenic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
922763179 1:228144843-228144865 CCTTTCCCTTGGGGGCTGGGAGG + Intronic
1071544798 10:86521359-86521381 ACTTACCCTCGGAGCCTGGCGGG + Exonic
1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG + Intergenic
1075567234 10:123513675-123513697 CCTTTCTCTCTGAGCTTGGTGGG + Intergenic
1077145454 11:1042356-1042378 GCTTGCTCTCCGAGGGTGGCTGG + Intergenic
1077593998 11:3515923-3515945 CGTTTCTCTAGGACGCTGGAAGG - Intergenic
1078742647 11:14081575-14081597 CCATTCTCTCTGTGGGTGGCAGG + Intronic
1078780957 11:14439015-14439037 CCTCTTTCTCTGAGACTGGCAGG + Intergenic
1078971435 11:16417022-16417044 ACTTTCTCACCAAGGCTGGCTGG - Intronic
1081612216 11:44569301-44569323 GGTGTCTCTCGGAGGCTGGCTGG + Intronic
1084120455 11:67066079-67066101 CCTGTCCCTTGGAGACTGGCTGG - Intronic
1091263317 11:134251143-134251165 CCTTTCTCTAGGCGGCTCTCTGG + Exonic
1091650411 12:2304968-2304990 CACTTCTCTTGGTGGCTGGCTGG + Intronic
1091921586 12:4308962-4308984 CCTTTGTCTCTGAGGCTAGAGGG + Intergenic
1104162119 12:126191209-126191231 CCTTTCTCTCTGGGCCTAGCGGG + Intergenic
1104664235 12:130635982-130636004 ACCTTCACTCGGAGGCTGGAAGG - Intronic
1109197842 13:59398340-59398362 CCTTTTTTCCAGAGGCTGGCTGG - Intergenic
1112039813 13:95535622-95535644 CCTTTCTCCTGGTGGCTCGCAGG - Intronic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1119153775 14:72389541-72389563 CCTTGCTCTTTGATGCTGGCGGG - Intronic
1119744073 14:77032086-77032108 GCTTTCTCTAGCAGCCTGGCTGG - Intergenic
1122586107 14:102807581-102807603 CCTTTCACTTGGAGGATGGGTGG + Intronic
1124611800 15:31214550-31214572 CCTATCTGTAGGAGGCTTGCAGG + Intergenic
1124642123 15:31402261-31402283 TCTTCCTTTCAGAGGCTGGCGGG - Intronic
1125482111 15:40088229-40088251 CCTTTAGCTGGGAGGCTGGCTGG + Exonic
1125721799 15:41848721-41848743 GCTTATTCTAGGAGGCTGGCTGG - Intronic
1128637857 15:69314641-69314663 CCGTGCTCTTGCAGGCTGGCTGG + Intronic
1130514029 15:84612111-84612133 CCTTTCTCAGGGAGCCTGGAGGG + Intronic
1130742199 15:86612791-86612813 CCATTCTCTCTGAAGCCGGCTGG + Intronic
1132251058 15:100335527-100335549 TCTTTCTCTCTGAGCCTTGCTGG + Intronic
1132352520 15:101148821-101148843 CCTTTCTCTGGGTGCTTGGCCGG - Intergenic
1132501698 16:287312-287334 CCTGTGACTCAGAGGCTGGCAGG - Intergenic
1132511974 16:347555-347577 CCTTTCTCTCTGAGTGTTGCTGG - Intronic
1134248237 16:12555796-12555818 CCTTTCTTGCAGAGGCAGGCAGG - Intronic
1135183733 16:20296969-20296991 CCTTTCTCTCACAGGGAGGCTGG + Intergenic
1135415684 16:22266602-22266624 ACTTCCTCCCGCAGGCTGGCTGG + Intronic
1135491148 16:22910845-22910867 CCTTGTTCTCGGAGACTAGCAGG + Intronic
1136627523 16:31471438-31471460 GCTTTGTCTTGCAGGCTGGCTGG + Intergenic
1137585598 16:49662393-49662415 CCTTCCTCTTGGAGGATGGTTGG - Intronic
1137616037 16:49847621-49847643 CCATTCTCTCGGCGGGGGGCGGG - Intronic
1139610076 16:68049746-68049768 CCTTTCACTCACAGGCTTGCTGG + Intronic
1141642387 16:85348873-85348895 CCCATCTCTCGGGGGCTGGAGGG - Intergenic
1142194052 16:88731516-88731538 CCTGTCTCTCGGGGGCGGCCTGG - Intronic
1142537721 17:631333-631355 CCTCTCTTTCTGAGGCTGGAAGG + Intronic
1143010846 17:3865484-3865506 GCTTCCTGTAGGAGGCTGGCGGG - Exonic
1143270102 17:5669036-5669058 CCTCTCTTTCTGAGGCAGGCAGG - Intergenic
1143480527 17:7225304-7225326 CCTTTCTTTGGGAGGGAGGCAGG - Intergenic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1146172794 17:30646305-30646327 CCTCTCTCTCTTAGGATGGCTGG - Intergenic
1146346251 17:32062316-32062338 CCTCTCTCTCTTAGGATGGCTGG - Intergenic
1146937882 17:36823937-36823959 CCTCTCTGGCTGAGGCTGGCAGG - Intergenic
1147429526 17:40362986-40363008 CCGCACTCGCGGAGGCTGGCCGG + Exonic
1147774150 17:42888754-42888776 CCTGTCTCCAGGAGGCTGCCCGG + Intergenic
1147841380 17:43374218-43374240 CCTTTCTCTGGGATGCTCTCAGG + Intergenic
1148049122 17:44760482-44760504 CCTTCCTCTGGGAGGCAGGAGGG - Intronic
1148177814 17:45583073-45583095 ACTTGCCCTGGGAGGCTGGCTGG - Intergenic
1151051584 17:70984464-70984486 CCCTCCCCTCGCAGGCTGGCAGG - Intergenic
1151733561 17:75925080-75925102 CCTTTCCTTCTGAGGCTGGGTGG + Intronic
1152087146 17:78227276-78227298 CCATTCTCAGGGAGGCAGGCAGG - Intergenic
1152106818 17:78335002-78335024 ACTTTCTCTCGGAGTTTGACAGG + Intergenic
1152230828 17:79113214-79113236 CCTTCCTCCCAGAGGCTGCCCGG - Intronic
1156743324 18:40359431-40359453 CCTTTGTCTCAGAGGTTGGAGGG + Intergenic
1157237828 18:45980911-45980933 CCTGACTCTAGGAGGTTGGCAGG + Intergenic
1160130533 18:76221424-76221446 ACTTTCTCTGGGAGGGAGGCGGG + Intergenic
1160694934 19:478954-478976 CCTTTCCCTTGGAGACAGGCAGG + Intergenic
1161324807 19:3658503-3658525 CCTGTGTCTGGGAGGCTGGAGGG - Intronic
1161408608 19:4103710-4103732 CCTTTCTCTCCAAGCCTAGCTGG - Intronic
1162780568 19:13004778-13004800 CCCTTCTCTCGGTGGCTGCCAGG - Intronic
1162995737 19:14333812-14333834 CCCTTGTCCCGGAGGCTGGAGGG + Intergenic
1163763718 19:19150850-19150872 TCTTCCTCTCAGTGGCTGGCAGG - Intronic
1164502182 19:28829286-28829308 CTTTTCTCTGGGAGCCTGCCTGG + Intergenic
1165393338 19:35550635-35550657 CCTCTCTCTCCCAGGCTGGTGGG - Exonic
1165895515 19:39138894-39138916 CCCTACTCTGGGGGGCTGGCAGG + Intronic
1166589566 19:43984778-43984800 CCCTTCTCTTGGAGCCCGGCAGG + Intronic
928453199 2:31397344-31397366 GCTTTCCCTTGGAGACTGGCAGG - Intronic
929668336 2:43851205-43851227 CCTTTCTCCCCAAGGCAGGCTGG - Intronic
929821070 2:45274237-45274259 GGTTTCTCTGGGAAGCTGGCAGG - Intergenic
930928251 2:56847995-56848017 CCTTCCTGTTGGAGGGTGGCTGG + Intergenic
932878295 2:75475524-75475546 CCTTTCTCTGGAAGGCTGTATGG - Intronic
938319409 2:130353213-130353235 CCTTCCTCTGGGATGCTTGCGGG - Intergenic
941905186 2:170713064-170713086 CCTTTCCCAGGGAGGCGGGCAGG - Exonic
948487428 2:238289641-238289663 CCTTTCTCACGGAGCCTGTGGGG - Intronic
1168857961 20:1022507-1022529 CCTGTCTCTCGGAGTCAGGGAGG - Intergenic
1169185559 20:3614124-3614146 CCTGTTTCTGGGAGGGTGGCGGG + Intronic
1171131718 20:22660168-22660190 CCTTTCTTTCATAGGCAGGCAGG + Intergenic
1172646391 20:36472870-36472892 CCTTGCTCTGGGAGCCTGGCTGG + Intronic
1173923724 20:46765090-46765112 CCTTTCCCTGGGATGCTGGCAGG + Intergenic
1174541693 20:51294681-51294703 CCTTTCTCTCCTAGGCTGCAGGG + Intergenic
1175014832 20:55778459-55778481 TCATTCTCTAGTAGGCTGGCTGG - Intergenic
1175548927 20:59803117-59803139 CTTTTCCCTCGGTGGCTGCCAGG + Intronic
1175619378 20:60430651-60430673 CCATTCTCACGGCGGCTTGCAGG + Intergenic
1175822408 20:61917473-61917495 CCTTCCTGTGGGAGGCTCGCAGG + Intronic
1176025799 20:62985021-62985043 CCTGTTTCTCGGAGGCTCACAGG - Intergenic
1179884638 21:44308500-44308522 CCTTTCCCTGGGAGGAGGGCAGG - Intronic
1181116280 22:20634297-20634319 CCTTCCTCTCGGAGAATGGCTGG - Intergenic
1181442069 22:22941835-22941857 CCTTGCTGTGGGAGGCTGGGGGG + Intergenic
1181741659 22:24925980-24926002 CCTTTCTCTCTGCTGCTTGCTGG - Intronic
1184507020 22:44910035-44910057 CCTTTGGCACGGAGCCTGGCAGG + Intronic
953139096 3:40210934-40210956 CCCTTCCATTGGAGGCTGGCAGG - Intronic
957238609 3:77627576-77627598 CCTTTCTCTCTGAGGCACGCAGG + Intronic
959595799 3:108127299-108127321 CCATTCACTGGGAGACTGGCTGG - Intergenic
962994395 3:140611192-140611214 CCTCTGTCTCAGAGGCTTGCAGG - Intergenic
966744448 3:183262678-183262700 CCTTTCTCTAGGAAGCAGACAGG + Intronic
969365835 4:6693891-6693913 CCTTCCTCCTGGGGGCTGGCAGG - Exonic
969604434 4:8195454-8195476 CCTTCCTCTAGGAGGCTGCTGGG + Intronic
977610138 4:99022340-99022362 CCATGCTCTCTGAGGGTGGCGGG + Intronic
980698740 4:136395453-136395475 CCTTACTGCCGGGGGCTGGCGGG - Intergenic
981634261 4:146857614-146857636 CCCTTCTCCCAGAGGATGGCTGG - Intronic
982277944 4:153656032-153656054 CCTTCCTCTCTGAGTCTGGAGGG + Intergenic
985335053 4:188883386-188883408 CCTTGCTTTCGGAGGTTTGCCGG + Intergenic
985346917 4:189015857-189015879 CAATTCTCTTGAAGGCTGGCAGG - Intergenic
985543327 5:497121-497143 ACTGTCTCTCTGAGGCTAGCAGG - Intronic
985624935 5:980460-980482 CCTTTCTCTCGGCGCCCGCCAGG - Intronic
985646463 5:1087026-1087048 CCTTTGTCTCCGCAGCTGGCGGG - Exonic
985787656 5:1907702-1907724 CCTGTATCCTGGAGGCTGGCTGG + Intergenic
987692834 5:21290488-21290510 CCTCTCTCTCTCAGGCTGGAGGG - Intergenic
990448361 5:55913884-55913906 CCTTTCTCTCAGTGTCTAGCAGG + Intronic
991747463 5:69759236-69759258 CCTCTCTCTCCCAGGCTGGAGGG + Intergenic
991750266 5:69796090-69796112 CCTCTCTCTCCCAGGCTGGAGGG - Intergenic
991799041 5:70339093-70339115 CCTCTCTCTCTCAGGCTGGAGGG + Intergenic
991801840 5:70375890-70375912 CCTCTCTCTCCCAGGCTGGAGGG - Intergenic
991826813 5:70634455-70634477 CCTCTCTCTCCCAGGCTGGAGGG + Intergenic
991829555 5:70670941-70670963 CCTCTCTCTCCCAGGCTGGAGGG - Intergenic
991891399 5:71338519-71338541 CCTCTCTCTCCCAGGCTGGAGGG + Intergenic
997438552 5:133892473-133892495 CTTTGCTCTCTGAGGATGGCTGG + Intergenic
997530574 5:134579068-134579090 CCTTGCTCTCGCGGGGTGGCCGG - Exonic
1000041154 5:157486237-157486259 CATTTCTCTTGGAGGTTGCCAGG - Intronic
1001303414 5:170554300-170554322 CCTTCCTCTCGGAGGCTCCAGGG - Intronic
1002544238 5:179928189-179928211 CCTTTCCCTCGGATGATGCCTGG + Intronic
1005520775 6:26598594-26598616 CCATGCTCTCTGAGGGTGGCGGG - Exonic
1005748720 6:28864005-28864027 CCTTTCTCTGGGGGGCGGCCAGG - Intergenic
1006788897 6:36686081-36686103 CCTCTCTCCCGGAGGTTGGGTGG + Exonic
1015817774 6:137228480-137228502 CCTTTCTCTTGGATGCTGCTGGG - Intergenic
1017041888 6:150314590-150314612 CCGTTGTCTCTGATGCTGGCAGG + Intergenic
1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG + Intronic
1017784309 6:157742212-157742234 CCTCACTCTCAGATGCTGGCTGG - Intronic
1017972259 6:159322972-159322994 CCATTCCCTTGGAAGCTGGCAGG - Intergenic
1019101498 6:169634401-169634423 CCTTTCTCCCGGATCCTGGTAGG - Intronic
1025170090 7:56748704-56748726 TCTTTCTCTCTCAGGCTGCCGGG + Intergenic
1025701795 7:63827014-63827036 TCTTTCTCTCTCAGGCTGCCGGG - Intergenic
1026112692 7:67470792-67470814 CCTTTCTCTGGTTGGCTGGAGGG - Intergenic
1026171202 7:67955357-67955379 CCTTTCTCTCTCAGGCTTGCGGG - Intergenic
1027648703 7:80837823-80837845 CTTTTCTCTTGAAGGCTGCCTGG + Intronic
1029274911 7:99398229-99398251 CCTTTCCCTCTGAGGCTTTCTGG - Intronic
1029415751 7:100442163-100442185 ACTGCATCTCGGAGGCTGGCAGG + Intergenic
1034990913 7:155547739-155547761 CCTGTCTCTCTGAGGCTTCCAGG + Intergenic
1035955620 8:4075983-4076005 TCTTTCTCTGGGAGGGTGGAGGG + Intronic
1037905412 8:22713418-22713440 CCTTTCTCTGGGAGCCTGGAGGG + Exonic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1042075813 8:64993479-64993501 CCTCTCTTAAGGAGGCTGGCTGG + Intergenic
1043622121 8:82207032-82207054 TCTTTCTCTCAGAGGCTCTCTGG + Intergenic
1045766235 8:105674292-105674314 CCTCTCTCTCACAGGCAGGCAGG - Intronic
1046342913 8:112882010-112882032 CCTTTTTCTGGGAGACTGGTAGG + Intronic
1047720765 8:127637130-127637152 TCTGTCCCTTGGAGGCTGGCAGG - Intergenic
1049790507 8:144470206-144470228 CCTGTCCCTGTGAGGCTGGCAGG - Intronic
1050507349 9:6361833-6361855 CCTTTCTTTAGGAAGCTTGCTGG - Intergenic
1053188375 9:36037613-36037635 CCTGTCCCCCGGGGGCTGGCAGG + Intronic
1061618928 9:131798340-131798362 CCTTGCTCTGGGAGGCTGCCTGG - Intergenic
1062653390 9:137590020-137590042 GCTTCCTCTCGCAGGCCGGCGGG - Intronic
1197934443 X:131726420-131726442 CCTTACACTTGCAGGCTGGCTGG - Intergenic
1198268938 X:135035836-135035858 CCTGTCACTAGGAGGCTGGAGGG + Intergenic
1199496588 X:148458979-148459001 ACTTTCTATCTGAGGCTGGGAGG + Intergenic
1201862508 Y:18615017-18615039 CCTGGCTCTTGGAGTCTGGCAGG + Intergenic
1201870815 Y:18705363-18705385 CCTGGCTCTTGGAGTCTGGCAGG - Intergenic