ID: 1017757920

View in Genome Browser
Species Human (GRCh38)
Location 6:157545378-157545400
Sequence AAAAAAAAGGAGGAGGAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4416
Summary {0: 1, 1: 10, 2: 90, 3: 617, 4: 3698}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017757915_1017757920 -6 Left 1017757915 6:157545361-157545383 CCTCTATGAAGATGTAAAAAAAA 0: 1
1: 0
2: 7
3: 84
4: 837
Right 1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG 0: 1
1: 10
2: 90
3: 617
4: 3698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017757920 Original CRISPR AAAAAAAAGGAGGAGGAGGC CGG Intronic
Too many off-targets to display for this crispr