ID: 1017766337

View in Genome Browser
Species Human (GRCh38)
Location 6:157610087-157610109
Sequence CTGTGAATATTTAAGGTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017766337_1017766341 -9 Left 1017766337 6:157610087-157610109 CCAACCACCTTAAATATTCACAG 0: 1
1: 0
2: 0
3: 20
4: 160
Right 1017766341 6:157610101-157610123 TATTCACAGACAGCTGAACTGGG No data
1017766337_1017766340 -10 Left 1017766337 6:157610087-157610109 CCAACCACCTTAAATATTCACAG 0: 1
1: 0
2: 0
3: 20
4: 160
Right 1017766340 6:157610100-157610122 ATATTCACAGACAGCTGAACTGG 0: 1
1: 0
2: 0
3: 7
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017766337 Original CRISPR CTGTGAATATTTAAGGTGGT TGG (reversed) Intronic
903046485 1:20567879-20567901 ATGTGAATATTTAAGGCAATGGG - Intergenic
905007932 1:34725996-34726018 CAGTGAAAGTATAAGGTGGTTGG - Intronic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
907714157 1:56912252-56912274 CTGTGAGGATCCAAGGTGGTGGG + Intronic
909262696 1:73513632-73513654 CTATGAATATTTCAGGTAGTAGG + Intergenic
909262823 1:73515915-73515937 CTATGAATATTTCAGGTAGTAGG - Intergenic
914419089 1:147512122-147512144 CTCTGAATATGAAAGGGGGTTGG - Intergenic
914452085 1:147801459-147801481 AAGTGAATATTTACTGTGGTTGG + Intergenic
915716230 1:157947635-157947657 CTCTGAATATTGAAGCTGGAAGG + Intergenic
918828345 1:189356374-189356396 TTGTCAATATTTAAGATGGGTGG - Intergenic
921413135 1:214858469-214858491 TTGTGAATATTTCAGGTTTTAGG + Intergenic
924114634 1:240733131-240733153 CTCTGAATATTTAAGGTGACGGG - Intergenic
1063095878 10:2908468-2908490 ATGTGAATGTTTAACGTCGTTGG + Intergenic
1064433767 10:15292779-15292801 GTGGGAATATTTATGGTGGTCGG - Intronic
1066073867 10:31851985-31852007 CTGAGTTTATCTAAGGTGGTAGG - Intronic
1068263941 10:54623053-54623075 CTGTGAATAATTAAGTTGATTGG - Intronic
1068414180 10:56696554-56696576 CTGAGAATATTAAAGATGGGTGG - Intergenic
1068893412 10:62172390-62172412 CTGTGAAAGTTTTAGGAGGTAGG + Intergenic
1069374346 10:67778988-67779010 CTGAGAATATTCGAGGTGGCAGG + Intergenic
1071213528 10:83371966-83371988 CTGAGAGAATTTAAAGTGGTTGG + Intergenic
1072611519 10:97020431-97020453 CTGTGTTTATTTAATGGGGTGGG - Intronic
1073384508 10:103112979-103113001 CTGTGTCTATTTAATGTGTTAGG - Intronic
1077831845 11:5881104-5881126 ATGTGTTTATTTAAGGTGGTGGG + Intronic
1078261332 11:9711917-9711939 CTGTGAGTATTTAATGTGAATGG - Intronic
1079746157 11:24132866-24132888 CTGTGAATCTTTCTGGTGTTTGG + Intergenic
1079790709 11:24735443-24735465 CTTTTATTCTTTAAGGTGGTTGG + Intronic
1080160426 11:29168455-29168477 TTGTTATTATTTATGGTGGTTGG + Intergenic
1081512920 11:43794601-43794623 CGGTGAATGTTTAAAGTGATTGG - Intronic
1084479305 11:69409430-69409452 CTGTGAATCTTTGGGATGGTGGG + Intergenic
1085455620 11:76663834-76663856 CTGGGAAGATTTAATGGGGTAGG - Intronic
1085929430 11:81063555-81063577 CTCTGAGTATTTTAGGTGGAAGG - Intergenic
1086082430 11:82918607-82918629 CTGTGAAGAATGATGGTGGTAGG + Intronic
1088267918 11:108005136-108005158 CAGTGGATATTTTAGGAGGTGGG + Intergenic
1088344028 11:108802392-108802414 CTGAAAATATGTCAGGTGGTTGG + Intronic
1089348516 11:117807584-117807606 CTGTGAATGTCTAAGGAGATGGG + Intronic
1091176807 11:133566282-133566304 CTATGGTTATTTAAGGTGATAGG - Intergenic
1093407305 12:18820205-18820227 GTATGAATATATATGGTGGTGGG + Intergenic
1095179250 12:39128038-39128060 CTGTGAATCTTTACGGTGAATGG - Intergenic
1095336000 12:41027257-41027279 CTGTGAATATTTAAAGCCATGGG + Intronic
1095679533 12:44957849-44957871 ATGTCAATATTTCAGGTGCTGGG - Intergenic
1097889420 12:64762042-64762064 CAATGAGCATTTAAGGTGGTGGG + Intergenic
1100055808 12:90508394-90508416 CTGTAACTATTTAAGGTTTTGGG + Intergenic
1100409601 12:94302148-94302170 CTGTGAAGACTTTAGCTGGTAGG - Intronic
1100935993 12:99666751-99666773 CTGTACATATTTAAGGTGTATGG + Intronic
1103605533 12:122083222-122083244 GTATGAATATTTCCGGTGGTGGG + Intronic
1105325058 13:19363329-19363351 CTGTGCCCATATAAGGTGGTGGG - Intergenic
1107326238 13:39245878-39245900 CTGTCAATCTTTCAGCTGGTTGG + Intergenic
1107503188 13:41002075-41002097 CTGTGAGTATATAAGGTGAGGGG + Intronic
1108184146 13:47871999-47872021 TTCTGATTATTTATGGTGGTGGG - Intergenic
1109245717 13:59952626-59952648 CAGAGAATAATGAAGGTGGTTGG - Intronic
1109660317 13:65450156-65450178 TTGCATATATTTAAGGTGGTAGG - Intergenic
1109793203 13:67276655-67276677 TTGTGAATTTTGTAGGTGGTAGG - Intergenic
1110905727 13:80886448-80886470 CTTTAATGATTTAAGGTGGTTGG - Intergenic
1113814987 13:113163383-113163405 TTGTGAATGGTTGAGGTGGTGGG - Intronic
1115012791 14:28570602-28570624 CTGTTAATAATTAACGTGATTGG + Intergenic
1116536102 14:46032468-46032490 CTGTGAAGAATTAAAGTGCTAGG - Intergenic
1117162035 14:52999437-52999459 CTGTGAATGTAGAAGGTGGGGGG + Intergenic
1117580697 14:57148794-57148816 TTATGAAAATTGAAGGTGGTTGG - Intergenic
1118855881 14:69621956-69621978 CTGTGAATAGTGAAGGTATTAGG + Intronic
1120415902 14:84217524-84217546 CTGTGATGATTTTAGGAGGTGGG + Intergenic
1124259680 15:28177502-28177524 CTGTGAATGTTGCAGGTGGCCGG - Exonic
1124699069 15:31895305-31895327 CTGTAAATATTTAAGAGAGTTGG - Intergenic
1124827404 15:33112352-33112374 CTATGAAGAGTTGAGGTGGTTGG + Intronic
1125021495 15:34991056-34991078 CTGTGAAGATTTGAGGGTGTGGG + Intergenic
1125932261 15:43608918-43608940 CTGTGAAGATTAAATGAGGTAGG - Intronic
1125945357 15:43708390-43708412 CTGTGAAGATTAAATGAGGTAGG - Intergenic
1130627629 15:85532172-85532194 CTGTGTAATTTTAGGGTGGTAGG - Intronic
1130722621 15:86404364-86404386 CTGTGAATATTTATTGTCATGGG + Intronic
1131752978 15:95529324-95529346 CTGACAATGTTTAAGATGGTGGG - Intergenic
1132192105 15:99874221-99874243 CTGTGAATAATTCAAATGGTTGG - Intergenic
1133367130 16:5219038-5219060 CTCTGAATATTTAAGGTTTGTGG - Intergenic
1138141625 16:54573613-54573635 CTATGAATATTTGGGGTGGGAGG - Intergenic
1143900591 17:10171618-10171640 CTGTGATTATTTAGGGAGATGGG - Intronic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1150998223 17:70343572-70343594 CAATGAATATTTAAGGTACTAGG + Intergenic
1152489865 17:80623505-80623527 CGATAAATATTTAAGGTGATAGG - Intronic
1157085380 18:44575227-44575249 CTGTGAGTATCTTTGGTGGTAGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159161971 18:64654305-64654327 CTGTGAAATTTTCAGGTAGTAGG + Intergenic
1163187869 19:15652519-15652541 CTGTGACTTTTTATGGGGGTGGG + Intronic
1166065765 19:40358023-40358045 CTCTGAATGGTTAAGGGGGTGGG - Intronic
926066811 2:9847376-9847398 CTGTGAGAATATAATGTGGTAGG + Intronic
927710378 2:25321932-25321954 CTGTCAATATTTAAGGAGGATGG + Intronic
928492904 2:31802926-31802948 CTGTAAGTATTCAAGGTAGTTGG - Intergenic
929975584 2:46631286-46631308 CTGTGAATGTTTAAAGTGTTAGG + Intergenic
939271525 2:139945721-139945743 TGGAGAAAATTTAAGGTGGTGGG - Intergenic
940162885 2:150732773-150732795 CTGTGTATAATAGAGGTGGTAGG - Intergenic
940343359 2:152603959-152603981 CTGTGAATACTTGTGGTTGTTGG - Intronic
941540702 2:166780476-166780498 CTGTGAATATTTAAGGAGACAGG - Intergenic
941899706 2:170666461-170666483 CTGTGAATATAGCGGGTGGTTGG + Intergenic
944515861 2:200510895-200510917 CTGTTAATATCTAAGGGGATAGG - Intronic
944536934 2:200719882-200719904 CTGTGAATCTGTAAGGTCTTGGG - Intergenic
944976318 2:205055705-205055727 ATGTGAATTATTAAGTTGGTTGG + Intronic
945550237 2:211212363-211212385 CTGTCAATATTTGAGGTGAAGGG - Intergenic
945799007 2:214401988-214402010 CTGTGGATATATAAGTTGGTTGG - Intronic
947470027 2:230392868-230392890 CAGTGAATATTTAAGGAAGAGGG - Intronic
947698011 2:232209049-232209071 ATGTATATATTTAATGTGGTGGG + Intronic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168903547 20:1386328-1386350 CAGTGAATATATAAGGAGCTGGG - Intronic
1169882313 20:10360606-10360628 CTTTGAATATAAAAGGTGTTAGG - Intergenic
1176016204 20:62934482-62934504 CTATGAATTTATAGGGTGGTGGG - Intronic
1177068449 21:16469751-16469773 CAGTGAATAATCAGGGTGGTGGG + Intergenic
1178071321 21:28970668-28970690 CTGTGATTCGTGAAGGTGGTCGG - Exonic
1178892623 21:36532837-36532859 CTGTGACTATTTAAAGGGATGGG - Intronic
1182826529 22:33270053-33270075 CTGTGAATATTTAATGGATTTGG - Intronic
1183310190 22:37105388-37105410 CTGTGAACATTTGAGGAAGTGGG - Intronic
1184512180 22:44940244-44940266 GTGGGAATAATTAAGGTGGCTGG - Intronic
959347325 3:105214858-105214880 TTGTGAATATTTATCTTGGTTGG + Intergenic
959421316 3:106133119-106133141 CACAGAATATTTGAGGTGGTAGG - Intergenic
962748465 3:138415435-138415457 CTGTGAATAGCTGAGGTGGGAGG - Intergenic
963250862 3:143102343-143102365 ATGTGGAGGTTTAAGGTGGTGGG + Intergenic
963502462 3:146145378-146145400 TTGTGATAATTTCAGGTGGTAGG - Intronic
964364750 3:155937981-155938003 CTGTGAATATGTATGAAGGTGGG + Exonic
967573141 3:191054844-191054866 ATTTAATTATTTAAGGTGGTGGG - Intergenic
969856711 4:10005809-10005831 CTGTCAATGTTAAAGGTAGTTGG + Intronic
970860370 4:20695738-20695760 TTGTAAATATTTAAGGTGTATGG - Intergenic
976110851 4:81672329-81672351 CTGTGAAATGTTAAAGTGGTGGG - Intronic
977416283 4:96736279-96736301 TTCTGAATATTTACGGTGGGAGG - Intergenic
980209389 4:129766211-129766233 CTGTCAAGAGTTAAGGAGGTGGG + Intergenic
981463386 4:145037413-145037435 CTGTTAAAATTTATGGTGATAGG - Intronic
982588048 4:157267423-157267445 CTTTGAATCTTTAATGTGGGAGG + Intronic
982595488 4:157378434-157378456 CTGTGAAAATTTAAGGACTTAGG + Intergenic
983925415 4:173396011-173396033 CTGTGAAGATGTATTGTGGTGGG + Intronic
984604872 4:181773766-181773788 CTCTGAAAATTTAAAGAGGTAGG - Intergenic
984813311 4:183814816-183814838 CTGTGAATATTAATAGTGGTTGG + Intergenic
986487848 5:8258166-8258188 CTGGGAATTTTTAAGGTGGCTGG - Intergenic
986806481 5:11312713-11312735 GTGTGAATGTTTAAGGCTGTGGG - Intronic
987431588 5:17841212-17841234 AAGAAAATATTTAAGGTGGTGGG + Intergenic
987689068 5:21244047-21244069 CTGTGCATCATTAACGTGGTTGG + Intergenic
989975935 5:50587181-50587203 CTGTGTGTATTGGAGGTGGTAGG + Intergenic
992538471 5:77737384-77737406 GTGTGATTATTTTATGTGGTGGG + Intronic
993540261 5:89140704-89140726 CTGAGACTATTTGAGGTTGTAGG + Intergenic
996281010 5:121729010-121729032 CTGAGAATGCTTAAGGTGGTTGG - Intergenic
997784206 5:136692864-136692886 ATGTGAATATTAAGGGAGGTAGG + Intergenic
1000207210 5:159073793-159073815 ATGAGAATATTCAAGGTTGTGGG + Intronic
1000814408 5:165903106-165903128 CTGTGAATATTTCAGGGAATAGG - Intergenic
1003160708 6:3631685-3631707 CTTGGAACATGTAAGGTGGTGGG - Intergenic
1003367127 6:5485473-5485495 CTGTTAAGATTTAAAGTGGGGGG + Intronic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1005365101 6:25068845-25068867 CTGTGGATACTTTAGCTGGTGGG + Intergenic
1008440642 6:51528360-51528382 CTGTGAAAATTTGAGGTGCAGGG + Intergenic
1008762745 6:54873161-54873183 CTGTTATTTTTTAAGGTGTTAGG + Intronic
1010023086 6:71184066-71184088 CTGTGAATCTTTATGGTCCTGGG - Intergenic
1011021907 6:82823708-82823730 CTGTTTATATTCAAGGTAGTTGG - Intergenic
1011628253 6:89300769-89300791 CTGTGAATATATCAGGTCCTGGG - Intronic
1011733029 6:90285506-90285528 CTGGGAATATTTAAGGGGAGAGG - Intronic
1012178612 6:96122454-96122476 CTGTGAATTTCTGTGGTGGTTGG - Intronic
1013820941 6:114153065-114153087 CTGGGAATATTCAAGCTGATAGG - Intronic
1017766337 6:157610087-157610109 CTGTGAATATTTAAGGTGGTTGG - Intronic
1020342866 7:7131467-7131489 CTGTGAAGATTAAATGTGGGAGG - Intergenic
1023506093 7:40901008-40901030 GTGTGTATATTGTAGGTGGTGGG + Intergenic
1024763101 7:52624448-52624470 TTGTAAATATTTAAAGTGGTAGG + Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1030948222 7:115754097-115754119 CTCAAAAAATTTAAGGTGGTAGG - Intergenic
1031842412 7:126760040-126760062 CAGAGAAGATTTGAGGTGGTGGG - Intronic
1032915407 7:136483799-136483821 CTGTGAATATTCAGGGTGGGGGG + Intergenic
1033133656 7:138767045-138767067 TTGTGAATTTTTAAAGTGCTTGG - Intronic
1033564681 7:142567184-142567206 CTTGGAAGATTTAAAGTGGTGGG - Intergenic
1035023199 7:155810540-155810562 CGGTCCAGATTTAAGGTGGTCGG + Intronic
1035156551 7:156919155-156919177 CTGTCAATAATTAAATTGGTTGG + Intergenic
1039238257 8:35526628-35526650 CTCTCAATATTTAAAGTGCTTGG - Intronic
1040514278 8:48121901-48121923 AAGTGATTTTTTAAGGTGGTGGG + Intergenic
1041389507 8:57336361-57336383 CTGGGAATACTTAAGGTCATTGG - Intergenic
1044115720 8:88330820-88330842 CTGTGAATATTCAAGGTTCTAGG + Intergenic
1044843719 8:96360097-96360119 GTGTGAAAATTTAAGGAGGCAGG - Intergenic
1044931500 8:97256337-97256359 CAGAGAATTTTTAAGGTGGTTGG - Intergenic
1047508934 8:125501638-125501660 CTGTGAGAATTTCAGATGGTTGG + Intergenic
1048909748 8:139123768-139123790 CTGTAAAGATTTAAGACGGTAGG + Intergenic
1049029936 8:140027279-140027301 CTGTGTATATGTTAGGTGGTTGG - Intronic
1057233750 9:93342340-93342362 CAATGAAAATTAAAGGTGGTAGG - Intronic
1057252094 9:93511683-93511705 CGATGAAAATTAAAGGTGGTAGG + Intronic
1059645617 9:116263844-116263866 CTGATGATATTTAAGGTGGTTGG - Intronic
1186274446 X:7924211-7924233 CTGGGCATATTTTAAGTGGTAGG - Intronic
1187465981 X:19528198-19528220 CTGTCAATGTTTTAGGTGCTGGG + Intergenic
1189652028 X:43200405-43200427 CTGTGAATATGTCAGGTCCTGGG + Intergenic
1192216420 X:69162507-69162529 CTGTGAGTATTTGTGGTGGTGGG - Exonic
1193466129 X:81849651-81849673 CTGTGAATGTTTTAGTTGGCTGG - Intergenic
1194804803 X:98314076-98314098 CTGTAAATATTTGAGGATGTTGG + Intergenic
1199535254 X:148895431-148895453 ATGTGTGTGTTTAAGGTGGTGGG - Intronic
1200736046 Y:6796712-6796734 CTGTGAATATTTCTGGTTCTGGG + Intergenic
1201447904 Y:14078656-14078678 TTGGGCATATTTTAGGTGGTAGG + Intergenic