ID: 1017768199

View in Genome Browser
Species Human (GRCh38)
Location 6:157624150-157624172
Sequence AATTAGGCACAAGCTGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 144}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017768199_1017768205 27 Left 1017768199 6:157624150-157624172 CCCAGCTCAGCTTGTGCCTAATT 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1017768205 6:157624200-157624222 AATGACACTAGCCTCCCCATTGG 0: 1
1: 0
2: 0
3: 4
4: 107
1017768199_1017768202 -2 Left 1017768199 6:157624150-157624172 CCCAGCTCAGCTTGTGCCTAATT 0: 1
1: 0
2: 0
3: 6
4: 144
Right 1017768202 6:157624171-157624193 TTCTTGCCAACTTTCTATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017768199 Original CRISPR AATTAGGCACAAGCTGAGCT GGG (reversed) Intronic
902674473 1:17999256-17999278 GATGAGGCAGGAGCTGAGCTAGG - Intergenic
905858524 1:41330753-41330775 AATTAGGCACCTGCAGTGCTGGG - Intergenic
909908255 1:81225940-81225962 AATGAGGTACATGCTGAGCATGG + Intergenic
909988729 1:82195145-82195167 AATTAGTCAGAAGTTGAGGTGGG - Intergenic
912675094 1:111672417-111672439 AATTAGGGAGTAGCTCAGCTGGG + Intronic
915489119 1:156241780-156241802 AAATAGGTTCAAGCAGAGCTGGG - Intronic
915520817 1:156442047-156442069 AATTACGAACAAACTGATCTTGG + Intergenic
917775113 1:178325488-178325510 TATTAGGAACTAGATGAGCTAGG + Intronic
918971990 1:191432136-191432158 AAGTAGGCAGAGGCTGGGCTTGG - Intergenic
919167529 1:193914794-193914816 AATTTGAGACAAGCTGAGTTTGG - Intergenic
920873340 1:209812351-209812373 TCTTAGGCCCAAGCTTAGCTTGG - Intergenic
921044959 1:211469536-211469558 AGTAAGGCACATGCTGAGCATGG - Intergenic
921297777 1:213721105-213721127 AAGCAGGCAGAAGCTGAGATAGG - Intergenic
922382399 1:225044519-225044541 CATTAGACACCAGCTTAGCTTGG - Intronic
923567924 1:235090667-235090689 AGAGAGGCAAAAGCTGAGCTGGG + Intergenic
1063475772 10:6327795-6327817 ATTTATGCAGAAGCTGAGTTTGG - Intergenic
1063520348 10:6735547-6735569 AATGAGGCACCATCTGAGATCGG - Intergenic
1063600357 10:7475296-7475318 AATTAAGCAAAAGCCCAGCTGGG + Intergenic
1068989691 10:63137815-63137837 TCTTTGTCACAAGCTGAGCTAGG + Intronic
1070517307 10:77220216-77220238 AATTAGGCAGAACTTGAACTTGG + Intronic
1071808833 10:89155630-89155652 GATCAGGCAGAAGATGAGCTAGG - Intergenic
1072462215 10:95630265-95630287 AATTAGGTTCAAGCTGGGCACGG - Intronic
1076367753 10:129933337-129933359 AATTTGGCACCAGACGAGCTGGG + Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081838624 11:46178383-46178405 AATTAGGGACAAGGTGATCTGGG + Intergenic
1082814373 11:57498660-57498682 GATTAGGCAGAAACTGGGCTGGG - Intronic
1084450984 11:69238048-69238070 AATTTGGTAGAAGCTGAGCTGGG + Intergenic
1088656502 11:112004828-112004850 ATTTGGTCAGAAGCTGAGCTGGG - Intronic
1094488387 12:30942962-30942984 AGTGAGGCACAGGCTGGGCTGGG - Intronic
1098090780 12:66898752-66898774 CATTGGGCACAAGCTGGACTAGG - Intergenic
1099118372 12:78656197-78656219 AATTAGAAACAAGCTGGGCATGG + Intergenic
1100496380 12:95129001-95129023 AATTAGGCAGTAACTGTGCTAGG + Intronic
1102222155 12:111201884-111201906 AATCAGGCAAAAGCAGAGCTGGG - Intronic
1103813041 12:123631290-123631312 ATGAAGGCAGAAGCTGAGCTTGG + Intronic
1108000935 13:45905085-45905107 AAATAAGCCCAAGCTGAACTGGG + Intergenic
1110091548 13:71454802-71454824 AATTGGGGACTAGCTTAGCTGGG - Intronic
1110539990 13:76697398-76697420 CATTAGGGAAATGCTGAGCTTGG - Intergenic
1114683654 14:24507568-24507590 AATTGGGTTAAAGCTGAGCTAGG + Intronic
1116316462 14:43401595-43401617 CATTGGGAACAAGCAGAGCTGGG - Intergenic
1119356001 14:74007107-74007129 AATTAGGTACTAGCTGGGCATGG + Intronic
1119636096 14:76274660-76274682 AATCTGGGACTAGCTGAGCTGGG - Intergenic
1126582845 15:50257244-50257266 AATGAAGCAGAAGCTGAGGTGGG + Intronic
1126758952 15:51951333-51951355 AATTAGGCACAAGTTTATTTGGG - Intronic
1129518040 15:76168831-76168853 AAGGAGGCACCAGCTGAGCCGGG + Intronic
1135156756 16:20059324-20059346 AGATAGGCACAGGCTGGGCTAGG - Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1135588598 16:23689867-23689889 CAGTGGGCACAAGATGAGCTTGG - Exonic
1136117003 16:28100966-28100988 AACTCAGCCCAAGCTGAGCTGGG + Intronic
1138413397 16:56857197-56857219 AAATAGCCACAAGCTGAGGCGGG - Intergenic
1138619702 16:58201266-58201288 AATGAGGCCCCAGCTGAGGTTGG - Intergenic
1140597364 16:76432186-76432208 TATTAGGCACAAGGGGAGCCTGG - Intronic
1141086331 16:81098078-81098100 ACTTAGTCACAGGATGAGCTAGG - Intergenic
1141091454 16:81133184-81133206 AATTAGGCAGAAGAAAAGCTGGG + Intergenic
1148653807 17:49268478-49268500 AATTTGTCACTAGCTGAGGTTGG + Intergenic
1153650055 18:7231539-7231561 CTTTCGGCACAAGCTCAGCTCGG - Exonic
1153851915 18:9102800-9102822 AAGGAGGCTCAAGCTGAGCCCGG + Intronic
1154358134 18:13638113-13638135 AAAGTGGCAGAAGCTGAGCTCGG + Intronic
1155060626 18:22224985-22225007 AACTTAGCACCAGCTGAGCTTGG - Intergenic
1158734074 18:60059859-60059881 GATGAGGAACAAGCTGAGTTTGG + Intergenic
1164464083 19:28472769-28472791 ATTTACACAAAAGCTGAGCTTGG - Intergenic
1165434642 19:35789286-35789308 GATGGGGCACAGGCTGAGCTCGG + Intergenic
1165495318 19:36149354-36149376 AATGAGGCACAGGCTGGGCGTGG - Intronic
1165930422 19:39354787-39354809 AATTTGGTACAAGATGAGGTTGG + Intronic
1166923623 19:46250105-46250127 CATTAGGCATTAGCTCAGCTTGG + Intergenic
1167975762 19:53224806-53224828 AAGGAGGCTCAAGCTGAGCCCGG - Intergenic
925945177 2:8855389-8855411 ATTTAAGCACTAGCTGACCTAGG - Exonic
926404938 2:12541505-12541527 AATTAGGAACTAGCTGAACAAGG + Intergenic
929152260 2:38758035-38758057 AGTTAGTCAGAAGCTGAGGTGGG - Intronic
930001190 2:46862578-46862600 CCTCAGGCAAAAGCTGAGCTGGG + Intergenic
932728671 2:74201467-74201489 AGTTACTCACAAGCTGAGGTGGG - Intronic
933468296 2:82685592-82685614 AAGTAGGCTCAAGCTGAGAGGGG - Intergenic
934968507 2:98743979-98744001 AACTAGGAAGTAGCTGAGCTGGG + Intergenic
943491726 2:188561880-188561902 ACTTAGTCACAAGCTGAGTAGGG - Intronic
943837449 2:192531372-192531394 TATTTGAAACAAGCTGAGCTTGG + Intergenic
945206159 2:207334661-207334683 AATTAGGAGGAAGCTGAGCTAGG + Intergenic
1175819253 20:61899828-61899850 AACCAGGCACTGGCTGAGCTGGG - Intronic
1176911775 21:14574192-14574214 AATTATGGACAATCTGAGGTGGG - Intronic
1177613991 21:23492409-23492431 AATTAAGCTCAAGCTCAACTAGG - Intergenic
1183107026 22:35622271-35622293 AGGGAGGCACAAGCTAAGCTGGG - Intronic
1183551418 22:38488814-38488836 ATTTTGGCAGAAGCTGGGCTTGG - Intronic
949852420 3:8432776-8432798 ATTCTGGCAAAAGCTGAGCTGGG - Intergenic
951119819 3:18913363-18913385 AATTAGGAAAAAGCAGAGCAGGG + Intergenic
951149707 3:19274653-19274675 AATTAGGAACAAGAGGAGCCTGG - Intronic
952454303 3:33458284-33458306 AATTAGGCATCAGCTGGGCAGGG - Intergenic
952912275 3:38201199-38201221 AAATAGGCAAAAGTTGAGCTGGG - Intronic
953416677 3:42724564-42724586 AATTAGGATCTAGCTGAGTTAGG - Intronic
955527751 3:59838499-59838521 AAGAAGACACAAGCTGAGATGGG - Intronic
956141537 3:66151381-66151403 AGTGAGACACAACCTGAGCTGGG - Intronic
959035091 3:101352930-101352952 AATTAACTAAAAGCTGAGCTTGG + Intronic
962806353 3:138930200-138930222 AATTAGGCACTGGCCGGGCTTGG - Intergenic
962941607 3:140129739-140129761 AATCAGGCACCAGATCAGCTGGG + Intronic
965022967 3:163258538-163258560 AATCATTCACAAGCTTAGCTTGG + Intergenic
965577710 3:170234921-170234943 AATTAGCCAGAGGCTGAGGTGGG - Intronic
966139341 3:176737119-176737141 TACTAGGCAGAAGCTGTGCTAGG - Intergenic
966773915 3:183527670-183527692 AAGTAAGCACAAGCCCAGCTAGG + Intronic
968878965 4:3288845-3288867 AATTAGAGACAAGGAGAGCTGGG - Intergenic
970083106 4:12312381-12312403 AATTAGGCATAAGATAAGCAAGG - Intergenic
973915943 4:55635355-55635377 CAATAGGGACATGCTGAGCTTGG - Intronic
975572382 4:75831459-75831481 AGATATGCACAAGCTCAGCTGGG + Intergenic
977916649 4:102601719-102601741 ACTTCGGCAGAAGCAGAGCTTGG + Intronic
978579738 4:110220046-110220068 ACCTAGGCTCAAGCTGAGATGGG + Intergenic
986503344 5:8424741-8424763 AAAAAGGCACAAACTGGGCTGGG - Intergenic
990145831 5:52759112-52759134 AAAAGGGCACAATCTGAGCTGGG - Intergenic
990950404 5:61293037-61293059 AATGAGGCAGAGGCAGAGCTGGG + Intergenic
992138316 5:73770010-73770032 AATTAGCCAAAGGCTTAGCTTGG - Intronic
995488624 5:112665478-112665500 AATTAGACACAGGCTGGGCGTGG - Intergenic
995560433 5:113375223-113375245 AATTAAGTCCAAGCTGATCTTGG - Intronic
996433207 5:123403307-123403329 GAGTAAGCACAAGATGAGCTTGG + Intronic
996445836 5:123549390-123549412 AATTAGCCAAAAACTCAGCTGGG + Intronic
999671221 5:153960527-153960549 AATCAGGCACACGCTGGGCATGG - Intergenic
1000209727 5:159098179-159098201 ATTAAGCCACCAGCTGAGCTTGG - Intronic
1000488792 5:161882812-161882834 AATTGGGCATCAGTTGAGCTGGG + Intronic
1001395652 5:171418552-171418574 CATCAGGCTCAAGCAGAGCTTGG + Intergenic
1001585411 5:172830883-172830905 AATTCGGGAGCAGCTGAGCTGGG + Intergenic
1006866856 6:37215731-37215753 GAGTAGGCAATAGCTGAGCTTGG + Intronic
1007716271 6:43857933-43857955 ACTTAGGCCCCTGCTGAGCTCGG + Intergenic
1008510118 6:52268089-52268111 ACTTAGGGACAAGAGGAGCTAGG - Intronic
1009684761 6:66942891-66942913 AATTAGGCAGAAGGTGAAATTGG + Intergenic
1015888138 6:137941882-137941904 AATTAGTAAAAAGTTGAGCTGGG - Intergenic
1017768199 6:157624150-157624172 AATTAGGCACAAGCTGAGCTGGG - Intronic
1020118197 7:5488037-5488059 CCTCAGGCACAAGCTGAGCCCGG - Intronic
1025131529 7:56376611-56376633 CATGAGGCAGAAGCTGAGTTAGG + Intergenic
1025182330 7:56829677-56829699 CATGAGGCAGAAGCTGAGTTAGG + Intergenic
1025182751 7:56831891-56831913 AGTGAGGCACATGCTGGGCTGGG + Intergenic
1025689175 7:63745083-63745105 AGTGAGGCACATGCTGGGCTGGG - Intergenic
1029837782 7:103331251-103331273 AATTATGCACAAAATGAGCCAGG - Intronic
1029839783 7:103349778-103349800 AATTAGGACCAAGTTGAGATCGG - Intronic
1031750565 7:125567725-125567747 ATTAAGGCACAAGCTTTGCTGGG - Intergenic
1031850061 7:126852335-126852357 CATTAGACAAAAGCTTAGCTAGG + Intronic
1033399283 7:141006651-141006673 AGTTAGCCACATGCTCAGCTTGG + Intronic
1036079642 8:5540975-5540997 AATAAAGCACAAGTTGGGCTAGG + Intergenic
1038393880 8:27232264-27232286 GAGTAGGCAGAATCTGAGCTGGG - Intergenic
1040048740 8:42990634-42990656 AAATAGGCACAAGGAGAGCTGGG - Intronic
1041830010 8:62143483-62143505 CAGTGGGCACAAGGTGAGCTTGG + Intergenic
1045665536 8:104480450-104480472 AATTAGTCAAAGGCTGGGCTTGG - Intergenic
1046030141 8:108773890-108773912 AATTTGGGACCAGCTTAGCTGGG - Intronic
1046772635 8:118131593-118131615 AATTAGGAAGAGGATGAGCTGGG - Intergenic
1050193929 9:3060087-3060109 AGCTAAGCACAAGATGAGCTGGG + Intergenic
1052341599 9:27369401-27369423 AACTAGGCAGGAGGTGAGCTAGG - Intronic
1053261605 9:36670959-36670981 AACAAGGCACAAGTAGAGCTGGG - Intronic
1055045723 9:71922087-71922109 AATTAGCCAGAAGCTGTGGTGGG - Intronic
1057660655 9:96998526-96998548 AATTAAGCACAGGCTGGGCACGG + Intronic
1058755781 9:108081911-108081933 AGTGAGGCACAGGGTGAGCTGGG + Intergenic
1059263910 9:113007824-113007846 AATTAGCCACTGGCAGAGCTAGG + Intergenic
1060295596 9:122340916-122340938 GATGAGGCACAAGCTGGGCCTGG - Intergenic
1060578764 9:124724210-124724232 AATTATGTAAAAGATGAGCTCGG + Intronic
1061505740 9:131030976-131030998 ACTCAAGCACAAGCTTAGCTTGG + Intronic
1190990821 X:55548597-55548619 TATTGGGCACAAGATAAGCTAGG + Intergenic
1191099009 X:56705021-56705043 ATTTAGGCAGACACTGAGCTAGG - Intergenic
1195496961 X:105547523-105547545 AATTTGGGCCAAGCTTAGCTAGG + Intronic
1201289852 Y:12412794-12412816 AATTTGGCACCATCTGACCTGGG + Intergenic