ID: 1017770225

View in Genome Browser
Species Human (GRCh38)
Location 6:157638876-157638898
Sequence GGTTCTAGTGGGGGACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017770215_1017770225 3 Left 1017770215 6:157638850-157638872 CCGTGCAGGGCTGTGGGAGATGG 0: 1
1: 0
2: 3
3: 45
4: 400
Right 1017770225 6:157638876-157638898 GGTTCTAGTGGGGGACATGGAGG 0: 1
1: 0
2: 0
3: 21
4: 191
1017770214_1017770225 6 Left 1017770214 6:157638847-157638869 CCTCCGTGCAGGGCTGTGGGAGA 0: 1
1: 0
2: 1
3: 68
4: 325
Right 1017770225 6:157638876-157638898 GGTTCTAGTGGGGGACATGGAGG 0: 1
1: 0
2: 0
3: 21
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017770225 Original CRISPR GGTTCTAGTGGGGGACATGG AGG Intronic
900031472 1:375874-375896 TGTTGTATTGAGGGACATGGAGG - Intergenic
900052023 1:604074-604096 TGTTGTATTGAGGGACATGGAGG - Intergenic
900386923 1:2414810-2414832 GGTTCTGGGGTGGGGCATGGGGG + Intergenic
900851490 1:5146399-5146421 GGTACTTGTGGTGGACAAGGTGG - Intergenic
900933895 1:5753486-5753508 GGCTCCAGCGGGGGACCTGGGGG - Intergenic
901434453 1:9238163-9238185 GGACCTGGTGGGGGACATGGGGG + Intronic
901449805 1:9329089-9329111 AGTTCGCGTGGGGGACAGGGTGG + Intronic
901677158 1:10892230-10892252 GGTGCCAGTGGGAGCCATGGAGG - Intergenic
902545406 1:17186553-17186575 GGATCTGTAGGGGGACATGGAGG + Intergenic
903951217 1:26997011-26997033 GCTTCTAGAGGGGGCCCTGGAGG - Intronic
906558584 1:46735921-46735943 CGTTCTAGAGGTGGAAATGGGGG - Intergenic
909924926 1:81427568-81427590 GGATCTGGTGATGGACATGGTGG + Intronic
914407446 1:147389931-147389953 AGTTCCAGTGGGGGTCCTGGTGG - Intergenic
916656531 1:166881406-166881428 GGTTATACTGTGGTACATGGTGG + Intergenic
917965475 1:180176005-180176027 GGCTCCAGTGGGGGACAGGCTGG - Exonic
918900493 1:190410164-190410186 GTTACTAGTGGGGGAAATGGAGG + Intronic
919006841 1:191909501-191909523 GTTTCGAGTGAGGGACCTGGTGG - Intergenic
921328000 1:214006720-214006742 AGTTCTAGGAGGGGACATGGAGG + Intronic
924378650 1:243439707-243439729 GTTTCTAGAGGGGGAAATTGAGG + Intronic
924419584 1:243895846-243895868 GATTCTGGTGGGAGACTTGGAGG - Intergenic
1067295180 10:44971567-44971589 GGCCCTGGTGGGGGGCATGGGGG - Intronic
1069613636 10:69792239-69792261 GGTTATAGTGGTGGTGATGGTGG - Intergenic
1070625444 10:78047770-78047792 GTTTCTATTGGGGGAGGTGGGGG + Intronic
1070664497 10:78333565-78333587 GCTTATAGTGGGGGAAGTGGGGG + Intergenic
1075042393 10:119118639-119118661 AATTATACTGGGGGACATGGGGG + Intronic
1076000263 10:126907389-126907411 GGGTGTAGTGGGGGCCATCGGGG + Intronic
1077308941 11:1880068-1880090 GGGCCTAGTGGGGGACACAGAGG - Exonic
1078590978 11:12640880-12640902 TGTTGTGGTGGGGGATATGGGGG - Intergenic
1078829501 11:14966049-14966071 CATTCTAGTGGGGGAGATTGAGG - Intronic
1081868497 11:46372525-46372547 AGGTTTTGTGGGGGACATGGGGG + Intronic
1082941125 11:58706615-58706637 GGTGCTGTTGGGGGGCATGGTGG + Intronic
1084882765 11:72183544-72183566 GTTTCTAGTGGGGGAGGTTGGGG + Intergenic
1087517002 11:99176697-99176719 GGTTGTAGTGGTGGAGGTGGTGG - Intronic
1088425155 11:109693921-109693943 AGTTCCAGTGGTGGTCATGGTGG - Intergenic
1090268699 11:125370909-125370931 GGTTCTAGCAGGGGCCATGATGG - Intronic
1091270553 11:134308514-134308536 GGTAGTGGTGGTGGACATGGTGG - Intronic
1091324463 11:134676070-134676092 GGTCCTTGTGAGGGTCATGGAGG + Intergenic
1092330142 12:7579245-7579267 TGTTTTATTGGGGGACCTGGTGG - Intergenic
1094362073 12:29640889-29640911 GGTTGTTGAGGGGGGCATGGTGG + Intronic
1095732657 12:45522253-45522275 AGCTGTTGTGGGGGACATGGTGG + Intergenic
1097295455 12:57958031-57958053 GGCTGTGGTGGGGGGCATGGTGG + Intergenic
1102316220 12:111889968-111889990 GGTTTTAGTGTGAGAGATGGAGG - Intronic
1104606961 12:130196930-130196952 GGTGAGAGTGGGGGAGATGGAGG + Intergenic
1107071647 13:36276624-36276646 GGGTGTAGTGGAGGACAAGGGGG + Intronic
1108719871 13:53119888-53119910 GGGTCTATTGGGGGACATTTAGG - Intergenic
1109392468 13:61710281-61710303 GGTGGTGGTGGGGGAAATGGGGG - Intergenic
1112349244 13:98619087-98619109 AGGGTTAGTGGGGGACATGGGGG + Intergenic
1113965864 13:114153498-114153520 GGATGTAGTGGTGGAGATGGTGG - Intergenic
1114549255 14:23523778-23523800 GGGACCAGTGGGGGACCTGGAGG - Exonic
1116503688 14:45651839-45651861 GGCTCTAGTGATGGACATGGAGG - Intergenic
1117014632 14:51506085-51506107 TGTTCCAGTGGTGGACATGGGGG - Intronic
1118338800 14:64878491-64878513 GGTTATAGTGGGGGAAGGGGTGG + Intronic
1118772828 14:68953352-68953374 GCATGGAGTGGGGGACATGGAGG - Intronic
1120187954 14:81414110-81414132 AATTCTGGTGGAGGACATGGTGG + Intronic
1121564285 14:94896890-94896912 GGTTCTGGTGGGGGATCTTGGGG - Intergenic
1125004956 15:34806925-34806947 GGTGGTGGTGGGGGGCATGGAGG - Intergenic
1126681722 15:51208736-51208758 GGTGGGAGTGAGGGACATGGGGG - Exonic
1127306566 15:57711584-57711606 AGTTCTAGTGGGAGACAGGGAGG - Intronic
1127578299 15:60313813-60313835 GATGCTAGTGGGGGAAATGCAGG - Intergenic
1129681219 15:77659508-77659530 TGTTCCAGTTGTGGACATGGAGG + Intronic
1130392636 15:83472848-83472870 TGCTCTGGTAGGGGACATGGGGG + Intronic
1130637667 15:85640645-85640667 GGTTCTAGGAGGCTACATGGGGG - Intronic
1131974249 15:97927365-97927387 GGTTCCAGTTTGGGACATGTTGG - Intergenic
1133099334 16:3469778-3469800 GGTTCTAGGTGGGCACATGAGGG + Intronic
1136180680 16:28549736-28549758 GGGTATGGTGGGGGACAGGGAGG - Intergenic
1137323684 16:47411694-47411716 GGCTCCAGTGGGGGTCCTGGCGG - Intronic
1137562421 16:49511268-49511290 CGTTCTAGAGGGTGACATGGAGG - Intronic
1137775236 16:51048669-51048691 GCATCTTGTGGGAGACATGGAGG + Intergenic
1138703656 16:58892423-58892445 GGTAGTAGTGGGGGTGATGGTGG - Intergenic
1139723101 16:68873111-68873133 GCTTCTTTGGGGGGACATGGGGG - Intronic
1139776006 16:69317368-69317390 GCTTCTGGTGCGGGGCATGGTGG + Intronic
1140280100 16:73546197-73546219 GGTTGTAGTGGGGGAAAGGGAGG - Intergenic
1142642796 17:1294430-1294452 GGTTCTTGGGTGGGAAATGGAGG + Intronic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1147044003 17:37739664-37739686 GGTACTAGTGGGAGACATCTGGG + Intronic
1148764562 17:50029508-50029530 GGTTCTGATGGAGGACATAGAGG + Intergenic
1150113155 17:62520051-62520073 GGTTCTAGTGGTAGACTAGGTGG + Intronic
1151290423 17:73146018-73146040 GGTTGTAGTGGGGAAGCTGGAGG - Intergenic
1152948180 17:83209839-83209861 TGTTGTATTGAGGGACATGGAGG + Intergenic
1153639786 18:7146916-7146938 AGTTGAAGTGGGGGACAGGGAGG - Intergenic
1155742139 18:29301546-29301568 GGTTCTACTGAGGGCCATTGGGG + Intergenic
1156466531 18:37351102-37351124 GGTGCTGGTGGGGGAGAGGGGGG + Intronic
1159679116 18:71325521-71325543 AGGCCTAGTGGGGGTCATGGTGG + Intergenic
1162526387 19:11209192-11209214 GGTCCTTGGGGCGGACATGGGGG - Intronic
1163015446 19:14451498-14451520 GGTTCTAGGGGAGGACTCGGTGG - Intronic
1163723147 19:18907687-18907709 GGGTCCAGTTAGGGACATGGAGG - Intronic
1164760763 19:30726691-30726713 GGTGGGAGTGGGGAACATGGAGG + Intergenic
1165783363 19:38446592-38446614 GGGTCTAGGGGTGGACGTGGAGG + Intronic
1165856783 19:38883753-38883775 TGTTCTAGAGGGAGAGATGGAGG + Exonic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166361887 19:42255881-42255903 GGTCCTAGTAGTGGACGTGGGGG - Intergenic
1166749021 19:45155983-45156005 GCTGATAGTGGGGGCCATGGAGG - Intronic
1167319230 19:48785678-48785700 GGGTCCAGGGAGGGACATGGTGG - Intergenic
930246855 2:48992427-48992449 GGCTCCAGTGGGGGACATCATGG - Intronic
933766184 2:85711184-85711206 GGGTCAAGTGGGGACCATGGAGG + Intergenic
936015560 2:108956437-108956459 AGTGCTAGTGGAGGACATGGAGG - Intronic
936295518 2:111264667-111264689 GCTTCTAGCTGGGGATATGGGGG + Intergenic
937888388 2:126916015-126916037 GACTCTGCTGGGGGACATGGTGG + Intergenic
938732952 2:134160590-134160612 TGTTCTGGTGGGGGAAGTGGAGG - Intronic
942503871 2:176621098-176621120 GGTTCTTGGGGGTGACATGGAGG - Intergenic
946432621 2:219633689-219633711 GGTGGTAGTTGGGGACATCGAGG + Intronic
946788008 2:223268360-223268382 GGTGGAAGTGGGGGACATGTTGG - Intergenic
947620508 2:231587668-231587690 GGTTTTAGTGGGCCACATGAGGG + Intergenic
947793587 2:232880919-232880941 GGCTCTAGGGGAGGACAGGGAGG + Intronic
948240593 2:236429774-236429796 GGCTCCAGTGGGGGACAGGTAGG + Intronic
948749366 2:240122157-240122179 GGATGCAGTTGGGGACATGGAGG + Intergenic
1169654088 20:7903458-7903480 GGTGGTAGTGGTGGTCATGGTGG + Intronic
1170872251 20:20217054-20217076 GGTTCAAGTGAAGGACTTGGAGG - Intronic
1173279234 20:41613431-41613453 GGTTGGAGTGGGAGACATGGAGG - Intronic
1173463914 20:43266217-43266239 GATTCCAGTGGTGGCCATGGAGG - Intergenic
1173481559 20:43404490-43404512 GGTTCTTGTGGGAGATTTGGAGG - Intergenic
1175452315 20:59079922-59079944 GGTTCAAGGGCCGGACATGGTGG - Intergenic
1175727767 20:61331491-61331513 AGCTCTGGTGGGGGACATGCTGG - Intronic
1175921080 20:62450923-62450945 GGTTCTGGGAGGGGACCTGGGGG - Intergenic
1176235466 20:64051633-64051655 GGGTGTTGTGGGGGACGTGGAGG - Intronic
1177507164 21:22034165-22034187 GGTTTTAGTGGCAGAGATGGAGG - Intergenic
1178834327 21:36083723-36083745 GCTTCTAGAGGCGGGCATGGTGG + Intergenic
1182074845 22:27488456-27488478 GGTGCTGGTGGGGGCCAGGGAGG + Intergenic
1183212573 22:36459947-36459969 GTTTATGGAGGGGGACATGGAGG - Intergenic
1183242256 22:36666846-36666868 CGGTCTAGTGGGGGACAGGATGG - Intronic
1183397599 22:37581124-37581146 GGGCTGAGTGGGGGACATGGAGG + Intronic
1183484078 22:38080133-38080155 GGTGGGAGTGGGGGACATGAGGG - Intronic
1183485803 22:38087153-38087175 GGGTGTCATGGGGGACATGGAGG + Exonic
1184290375 22:43495610-43495632 GGTAGTAGTGGTGGAGATGGTGG + Intronic
949205053 3:1427997-1428019 GGTTGTAGGGGGAGACATGAGGG + Intergenic
950186483 3:10948644-10948666 GGCCCTGGTGGTGGACATGGTGG - Intergenic
951224921 3:20109975-20109997 TGTGCTAGTGGTGGAAATGGTGG - Intronic
951823139 3:26836523-26836545 GATTTTAGTGGGGGTCAGGGAGG + Intergenic
952893146 3:38057739-38057761 CTTTCTAGAGTGGGACATGGTGG + Intronic
952947154 3:38486070-38486092 GGTTCTGGTGTGGGACTTTGCGG + Exonic
953428727 3:42818987-42819009 GGTGTTGGTGGGGGAAATGGGGG + Intronic
954509738 3:51113154-51113176 TGTTCTAGAGGGGGAGATAGAGG + Intronic
957174403 3:76787138-76787160 GGGTTGAGTGAGGGACATGGTGG - Intronic
958263009 3:91404313-91404335 GGCTGTTGTGGGGGGCATGGTGG - Intergenic
958938528 3:100284662-100284684 GGTTGTAGTGGGGGTCGTGGTGG + Intronic
961206356 3:125085500-125085522 GGTTATAGTTGGGGACTGGGAGG + Intronic
962866631 3:139452728-139452750 GTTGGTTGTGGGGGACATGGGGG - Intergenic
962962385 3:140322408-140322430 GATGCTGGTGGGGGAGATGGAGG + Intronic
965798520 3:172467047-172467069 AGTTCTAGTGGGGGATTTGGAGG - Intergenic
965950023 3:174297541-174297563 GGTTCTAGTGGGTATCATGAGGG - Intergenic
968673928 4:1866861-1866883 GATTAGAGTCGGGGACATGGGGG - Intergenic
971763362 4:30798089-30798111 GGCTCTAGTGGAGGACAAGTTGG + Intronic
972543479 4:40058442-40058464 GGCTGTAGTGGTGGACATGGTGG + Intronic
972633011 4:40857792-40857814 GGGGCGAGTGGGGGAAATGGGGG + Intronic
974557698 4:63472728-63472750 GGTTATAGTGGCAGAAATGGAGG + Intergenic
974878871 4:67730102-67730124 GGTTCTGGTGAGGGCCATTGTGG - Intergenic
975033785 4:69657024-69657046 GGTTGTTGAGGGGGACACGGTGG + Intergenic
978233704 4:106431831-106431853 GGTGGTAGTGGTGGTCATGGTGG - Intergenic
978712149 4:111797178-111797200 GGTTCAAATGGTGGTCATGGCGG - Intergenic
979704819 4:123709153-123709175 GTCTGTTGTGGGGGACATGGTGG + Intergenic
981029056 4:140105702-140105724 GTTGCCTGTGGGGGACATGGAGG + Intronic
981503619 4:145477528-145477550 TGTTCTAGCAGGGGATATGGTGG - Intergenic
985717475 5:1470783-1470805 GGTTTGACTGGGGGACAGGGCGG - Intronic
986023866 5:3831461-3831483 GGTCCCAGTGAGGGACCTGGTGG + Intergenic
986048255 5:4062054-4062076 CATTCTAGTGGGGAAGATGGAGG - Intergenic
988554808 5:32226862-32226884 CGTTCTTGTGGGGCACAGGGAGG - Intergenic
990000890 5:50891453-50891475 GTTTCAAGGGAGGGACATGGTGG - Intergenic
992886140 5:81162191-81162213 GGGGGTGGTGGGGGACATGGGGG + Intronic
993917020 5:93756023-93756045 GGCTGTTGTGGGGGGCATGGTGG + Intronic
995965025 5:117895087-117895109 GGTGGCAGTGGGGGACGTGGGGG + Intergenic
997472496 5:134124670-134124692 GGTTTTAATGGGGGGCAGGGCGG - Intronic
997685635 5:135786004-135786026 GGATCCAGTGGGGGAGACGGTGG + Intergenic
999124054 5:149233450-149233472 GGATCCAGTGGGGTACAGGGAGG + Intronic
999664129 5:153895082-153895104 GGTTTTAGTGGAGGAGATTGTGG - Intergenic
999733515 5:154494029-154494051 GTTTCTTCTGGGGGATATGGAGG - Intergenic
1001715380 5:173811088-173811110 GGTTATGGTGGTGGAGATGGTGG + Intergenic
1002057558 5:176607293-176607315 GGTTCTAGTGGGGTAGTTGCGGG - Intronic
1002742348 5:181442994-181443016 TGTTGTATTGAGGGACATGGAGG + Intergenic
1004158358 6:13191102-13191124 GGTTGGAGAGGAGGACATGGAGG - Intronic
1004561076 6:16751446-16751468 AGTCCCAGTGGGGGACAAGGTGG - Intronic
1007357320 6:41331301-41331323 GATTCTAACGGGGAACATGGAGG - Intergenic
1007704116 6:43780840-43780862 GGTTGTACTGGGGGCCAGGGAGG - Exonic
1008776728 6:55048760-55048782 GGATTTAGTGGAGGGCATGGAGG - Intergenic
1009931163 6:70179032-70179054 GGTCTTATTGTGGGACATGGCGG - Intronic
1013721072 6:113028544-113028566 GGCTCTTGGTGGGGACATGGTGG - Intergenic
1014110027 6:117609942-117609964 GTTTCCAGTGGAGAACATGGTGG + Intergenic
1015842055 6:137487655-137487677 AATTCCACTGGGGGACATGGAGG - Intergenic
1017770225 6:157638876-157638898 GGTTCTAGTGGGGGACATGGAGG + Intronic
1018908796 6:168090123-168090145 GGTCCCAGTGGTGGACGTGGAGG - Intergenic
1021406638 7:20275501-20275523 GGCACTAGTGTGGGACCTGGTGG + Intergenic
1022795978 7:33731655-33731677 GGTTGCAGTGGGTGAAATGGTGG - Intergenic
1023543761 7:41295381-41295403 TGTTCTAGTCAGTGACATGGTGG + Intergenic
1026656022 7:72257239-72257261 GTGTCTAGTGAGGGACCTGGTGG - Intronic
1026807233 7:73436002-73436024 GGTCCTAGTGGAGGATGTGGAGG + Exonic
1027220917 7:76213427-76213449 GGTCCTAGTTGGGGAAATGGAGG + Intronic
1030553525 7:110994630-110994652 GGTTGTAGGAGGGGACATGGAGG - Intronic
1031261335 7:119524944-119524966 GGTGCTATTGCGGGGCATGGTGG + Intergenic
1032316593 7:130843857-130843879 GGCTCTTGTGGGGGAAATGGAGG - Intergenic
1035204679 7:157287479-157287501 GGTTCCAGAAGAGGACATGGAGG - Intergenic
1035500654 8:89203-89225 TGTTGTATTGAGGGACATGGAGG - Intergenic
1037283866 8:17274791-17274813 GCTTCTTGTGGAGGATATGGAGG - Exonic
1040450651 8:47542843-47542865 GGTTCTGGAGGGTGACAGGGTGG - Intronic
1040711561 8:50195284-50195306 GGTTCTTGTGGGGGTCACGGTGG - Intronic
1047169953 8:122483162-122483184 GGCTCTAGGGGAGGAGATGGTGG - Intergenic
1047901906 8:129431948-129431970 GGTGCTGTTGGGGGGCATGGTGG - Intergenic
1048178261 8:132172020-132172042 AGGTCTAGTGGTGTACATGGTGG + Intronic
1048331973 8:133476828-133476850 GGTTCTTGTTGGAAACATGGAGG - Intronic
1050626618 9:7510990-7511012 GGTTCTGGTGGGAGATAAGGTGG + Intergenic
1051415972 9:16840960-16840982 GGTTATAGTGGTGGAACTGGTGG - Intronic
1052470142 9:28883497-28883519 GGTTTGAGTGGGGGAAATGAGGG - Intergenic
1055169464 9:73237749-73237771 GGTTGGAGTGGGGGAGATAGAGG + Intergenic
1055835659 9:80438037-80438059 TGTTGTAGTAGGGGCCATGGTGG - Intergenic
1056719360 9:89059414-89059436 GGATTTAGTGGTGGACATGGTGG + Intronic
1056719494 9:89059977-89059999 GGATTTAGTGGTGGACATGGTGG + Intronic
1056719559 9:89060252-89060274 GGATGTGGTGGAGGACATGGTGG + Intronic
1057196592 9:93119057-93119079 GGTGGTGGGGGGGGACATGGAGG - Intergenic
1062312066 9:135944210-135944232 GGTTACACTGCGGGACATGGTGG + Intronic
1062339935 9:136089469-136089491 GGTTGTGGGGGGTGACATGGAGG - Intronic
1203608257 Un_KI270748v1:74213-74235 TGTTGTATTGAGGGACATGGAGG + Intergenic
1190525044 X:51320722-51320744 GGATCTAGTGGGGGAGTTGTTGG + Intergenic
1190544546 X:51512030-51512052 GGATCTAGTGGGGGAGTTGTTGG - Intergenic
1193469913 X:81887637-81887659 GGTGCTATTGGGGGAGATGGGGG - Intergenic
1194926949 X:99836695-99836717 GGCTGTTGTGGGGGGCATGGTGG - Intergenic