ID: 1017773433

View in Genome Browser
Species Human (GRCh38)
Location 6:157661169-157661191
Sequence CACCACCCCCAGGTATCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017773433_1017773439 -6 Left 1017773433 6:157661169-157661191 CCCATGGATACCTGGGGGTGGTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1017773439 6:157661186-157661208 GTGGTGGGGAGCAGCCCAACAGG 0: 1
1: 0
2: 1
3: 14
4: 191
1017773433_1017773445 16 Left 1017773433 6:157661169-157661191 CCCATGGATACCTGGGGGTGGTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1017773445 6:157661208-157661230 GTAGCTGGATGGAACACTCAGGG 0: 1
1: 0
2: 0
3: 6
4: 110
1017773433_1017773441 5 Left 1017773433 6:157661169-157661191 CCCATGGATACCTGGGGGTGGTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1017773441 6:157661197-157661219 CAGCCCAACAGGTAGCTGGATGG No data
1017773433_1017773440 1 Left 1017773433 6:157661169-157661191 CCCATGGATACCTGGGGGTGGTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1017773440 6:157661193-157661215 GGAGCAGCCCAACAGGTAGCTGG 0: 1
1: 0
2: 0
3: 17
4: 236
1017773433_1017773444 15 Left 1017773433 6:157661169-157661191 CCCATGGATACCTGGGGGTGGTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1017773444 6:157661207-157661229 GGTAGCTGGATGGAACACTCAGG 0: 1
1: 0
2: 2
3: 19
4: 123
1017773433_1017773446 20 Left 1017773433 6:157661169-157661191 CCCATGGATACCTGGGGGTGGTG 0: 1
1: 0
2: 0
3: 18
4: 136
Right 1017773446 6:157661212-157661234 CTGGATGGAACACTCAGGGAAGG 0: 1
1: 0
2: 0
3: 14
4: 251

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017773433 Original CRISPR CACCACCCCCAGGTATCCAT GGG (reversed) Intronic
900983972 1:6062571-6062593 CCCCACCCCCTGGTGTCCCTGGG + Intronic
902079760 1:13813001-13813023 GGCCACCCCCAGGTCTCCAGCGG + Intronic
903682978 1:25109414-25109436 CACCACCACCAGGTATGCCTAGG + Intergenic
905116402 1:35644913-35644935 CACCACACCCAGCTCTCCCTAGG + Intergenic
905393435 1:37652489-37652511 CAGCACCCCCTAGCATCCATAGG + Intergenic
905657893 1:39697563-39697585 TACCACCCCCAGGCCTCAATGGG + Intronic
905780927 1:40708453-40708475 AATCATCCCCTGGTATCCATGGG - Intronic
907838892 1:58137521-58137543 AACCACCCCCATCCATCCATCGG + Intronic
910148066 1:84106169-84106191 AATCACCCCTTGGTATCCATGGG - Intronic
914428439 1:147599721-147599743 CACCACCTCCTGGTTTGCATAGG - Intronic
915310550 1:155004009-155004031 CACAACCCCCACGTATCAAAGGG + Intronic
915327038 1:155085999-155086021 CCCCACCCCCAGGAAGCCAGGGG - Intronic
921214316 1:212924276-212924298 CACCGCCCCCAGCTATGCACAGG - Intergenic
1063027298 10:2193080-2193102 CGCCATCTCCAGGTATCCAGTGG - Intergenic
1067337845 10:45379099-45379121 CGTCACCCCCAGGTAGACATCGG + Intronic
1069036157 10:63648185-63648207 CACCACACCCAGCTATCCAGGGG + Intergenic
1069995707 10:72340946-72340968 CCCCACAGCCAGGTATCCCTGGG - Intronic
1070785228 10:79158717-79158739 CCCCACCTCCAGGGATCCCTGGG - Intronic
1072671746 10:97435044-97435066 CACCACGCCCAGCTAACCTTTGG - Intergenic
1075408817 10:122212357-122212379 CACAATCCCCAGGAAGCCATTGG + Intronic
1079132684 11:17756851-17756873 CATCACCCCCAGGTAGTCCTGGG - Intronic
1080029490 11:27646077-27646099 CACCACCCCTAACTTTCCATTGG + Intergenic
1083628965 11:64086058-64086080 CACAGCCCCCAGGGCTCCATAGG - Intronic
1085242649 11:75071482-75071504 CACCACCCCCAGACCTTCATGGG - Intergenic
1085897566 11:80658213-80658235 CACCACCATTAGGTATACATTGG - Intergenic
1087843385 11:102943154-102943176 CACCCTCCCCAAGTATCAATAGG + Exonic
1095489335 12:42716821-42716843 CACCATCCCCAGACAGCCATGGG + Intergenic
1097675355 12:62596090-62596112 CACTAGTCCCAGGTAACCATTGG + Exonic
1101607531 12:106258900-106258922 CACCACCACCACAGATCCATGGG - Intronic
1105935684 13:25096207-25096229 CAGCACCCCCAGCTACCCAACGG + Exonic
1106122464 13:26872004-26872026 CCCCACTCCCAGCTATCCCTGGG - Intergenic
1107287737 13:38814841-38814863 CACCACCACCACTGATCCATGGG + Intronic
1110901846 13:80834312-80834334 CATCACCCCGAGGTATACCTGGG + Intergenic
1111665820 13:91266917-91266939 CACCACACCCATGTCTCCATTGG + Intergenic
1113764086 13:112870021-112870043 CACCACGGCCAGGTGTCCCTGGG + Intronic
1115729513 14:36253475-36253497 CAACACCCCAAGATAACCATTGG - Intergenic
1119232057 14:72987917-72987939 AACCACTCCCAGGTATGTATGGG + Intronic
1121941417 14:98074496-98074518 CCCCACCCCCAGATATTTATAGG - Intergenic
1123062227 14:105599546-105599568 CTGCACCCCCAGGTATAGATGGG - Intergenic
1123086971 14:105721274-105721296 CTGCACCCCCAGGTATAGATGGG - Intergenic
1123219665 14:106844026-106844048 CAGCAGCCCCAGCTGTCCATGGG - Intergenic
1123797082 15:23782912-23782934 CACCACCACCGGGAATCTATTGG + Intergenic
1124050110 15:26189374-26189396 CACCACCCCCAGGAGCCCAAGGG + Intergenic
1124433830 15:29631707-29631729 CCCCACCCCCAGCTAGACATGGG - Intergenic
1125676191 15:41503732-41503754 CACACACCCCAGGTGTCCATGGG - Exonic
1127107525 15:55632654-55632676 CACCTCCCCCAGATATCCACAGG + Intronic
1128432023 15:67605339-67605361 CACCACCCCCAGCCAGCCATGGG + Intronic
1128957425 15:71963235-71963257 CACCATGCCCAGCTAACCATTGG + Intronic
1129393540 15:75232572-75232594 CAGCACCCCCAGGGACCCTTGGG + Intergenic
1133101782 16:3484427-3484449 CACCACACCCAGGGATGCACGGG - Intronic
1134009872 16:10843915-10843937 CACCACCCACAGGCTCCCATTGG + Intergenic
1134266835 16:12700243-12700265 CACCACCTGCAGGTATACAAAGG - Intronic
1136578582 16:31138957-31138979 CACCACCCCCAAGGATTCCTGGG + Exonic
1137055835 16:35746344-35746366 CTCCAGCCCCAGGTCTCCCTAGG - Intergenic
1138275379 16:55730405-55730427 CACCACCACCACGTTTTCATGGG - Intergenic
1138280623 16:55770035-55770057 CACCACCACCACGTTTTCATGGG - Intergenic
1138287863 16:55823588-55823610 CACCACCACCACGTTTTCATGGG + Exonic
1138551836 16:57752707-57752729 CCCCACCCCGAGGAATCCAGAGG - Intronic
1140248074 16:73269257-73269279 CACCACCACCAGGGAGCCATTGG + Intergenic
1140905515 16:79406023-79406045 CACCAACCCCAGTCAGCCATTGG - Intergenic
1143098223 17:4489859-4489881 CACCACGCCCAGGTATGTTTTGG - Intergenic
1144863288 17:18319061-18319083 CACCTCCCCCAGGAATTCTTTGG - Intronic
1146457454 17:33018708-33018730 CACCACCACCAAATATCCTTTGG - Intronic
1147637317 17:41972042-41972064 CACCTCCCCCATGTGTCCCTGGG - Intronic
1148194012 17:45700285-45700307 CACCACCCCCATGTGACTATGGG + Intergenic
1151944478 17:77312015-77312037 CAGCACCCCCAGGTCTCAACAGG + Intronic
1152361455 17:79835009-79835031 CACCGCCCCCAGGTAGCCTTTGG + Exonic
1152912652 17:83013912-83013934 CACCAGCTCCAGGGATCCCTGGG + Intronic
1153650641 18:7236943-7236965 CACCACCCCCGGGCATACATAGG - Intergenic
1154322768 18:13368085-13368107 CACCACCCCCAGATATACCCAGG - Intronic
1155947475 18:31872167-31872189 CTCCAACCCCAGTTATCGATGGG + Intronic
1157876018 18:51274581-51274603 CACCACGCCCAGCTAGCCAGAGG - Intergenic
1158702568 18:59761854-59761876 CAGCACCCGCAGGTCTCAATCGG - Intergenic
1163289801 19:16371870-16371892 CACCTCCCCCAGGTAAACAATGG - Intronic
1166177157 19:41082220-41082242 CAGCACTCCCAGGCACCCATGGG - Intergenic
1167293115 19:48635379-48635401 CTCCTCCCCCATGGATCCATTGG + Intronic
1167621660 19:50564181-50564203 CACAACCCACAGTTATCCAGGGG + Intronic
927381370 2:22482800-22482822 AAACACCACAAGGTATCCATAGG - Intergenic
927583881 2:24281316-24281338 CACCACGCCCAGCCATCAATAGG + Intronic
927988197 2:27428557-27428579 CACCGCCGGCAGGTTTCCATTGG - Exonic
928735990 2:34289631-34289653 CACCACACCCGGGCCTCCATTGG - Intergenic
933715845 2:85359917-85359939 CACCATGCCCATGTAGCCATGGG - Intronic
933887490 2:86732781-86732803 CACCAACCCCAGGAATTAATGGG - Intronic
933922686 2:87063931-87063953 CACCAACCCCAGGAATTAATGGG + Intergenic
934047523 2:88185220-88185242 CACAAACCCCAGGGATCCAGTGG - Intronic
935894023 2:107714408-107714430 CACGCACCCCAGGTATCCTTGGG - Intergenic
936045990 2:109188364-109188386 CACCACCTCCAGGGTTGCATGGG + Intronic
936654590 2:114469994-114470016 CATCACCTCAAGGTGTCCATTGG - Intronic
939620020 2:144407421-144407443 CACCACCAATAAGTATCCATTGG - Intronic
942556758 2:177179524-177179546 CTCCACCCCAAGGTAAACATGGG - Intergenic
945027130 2:205630123-205630145 CTCCTCCCCCAGTTCTCCATGGG + Intergenic
945251647 2:207769751-207769773 CACCGCCCCCAGGAGTCCACTGG - Intergenic
945926924 2:215815329-215815351 CACAACCACCAGGTATTCATTGG + Intergenic
947231315 2:227889703-227889725 CCCCACCCCCAGATATCTCTTGG + Intronic
948302160 2:236915597-236915619 CACCACCCTCAGGGATTCAAGGG - Intergenic
1169463435 20:5816913-5816935 CACCACGCCCAGCTATTTATTGG - Intronic
1170034906 20:11979975-11979997 CACCACACCCTGGTTTCCATGGG - Intergenic
1170393529 20:15901994-15902016 GACCTCCCCCAGGGTTCCATTGG - Intronic
1170719075 20:18859531-18859553 CAGCAGCCCCAGGTATACCTGGG - Intergenic
1171139537 20:22729001-22729023 CACCACCACCAGGCAACCCTTGG - Intergenic
1171284015 20:23923187-23923209 CACCAGCCACAGGTGACCATGGG - Intergenic
1172479174 20:35260886-35260908 CCCCACCCCCATGTGTCCCTAGG + Intronic
1175397630 20:58677851-58677873 TGCCACCTCCAGGTAGCCATTGG + Exonic
1179908630 21:44436627-44436649 CATCACCCCCAGGTGGCCCTCGG + Intronic
1184610373 22:45599428-45599450 GAGCACCCCCAGTTCTCCATGGG - Intronic
954429126 3:50459878-50459900 CAGAACCCCCAGGAATCAATGGG - Intronic
954759903 3:52866477-52866499 CACCACACCCTGGTATCCTCAGG - Intronic
954871507 3:53770840-53770862 CACCACCACCAGGCATCCCGGGG - Intronic
955737487 3:62054918-62054940 CACCACTTCCATGTTTCCATGGG + Intronic
959409012 3:105997517-105997539 CACCACCACCACAGATCCATTGG + Intergenic
961863735 3:129938550-129938572 TGCCACCACCAGGTGTCCATGGG - Intergenic
961989732 3:131175574-131175596 TACCACCCCCAGGCAACCACTGG - Intronic
971048431 4:22831802-22831824 CCCCACCCCCGGGGATCCAGAGG + Intergenic
971087599 4:23296927-23296949 CACCACCCCCAAGTTTCAAAAGG - Intergenic
973784160 4:54319502-54319524 CCCTACCCCCAGGTAGCCTTTGG + Intergenic
980343710 4:131584403-131584425 TATCACCCCCAGGTTTCCATCGG + Intergenic
981651320 4:147062261-147062283 CCCCACCCCCATGTAGCTATGGG + Intergenic
985674962 5:1226202-1226224 CACCACCCCCAGAAGTGCATTGG + Intronic
987873832 5:23654147-23654169 CTTCACCCCCTGGTATCCATAGG - Intergenic
988238391 5:28575761-28575783 ACCCAACCCCAGGCATCCATAGG + Intergenic
997527430 5:134562352-134562374 CACCCACCTCAGGAATCCATAGG - Exonic
1003536220 6:6977978-6978000 GACCCCACCCAGGTGTCCATCGG + Intergenic
1003869175 6:10388335-10388357 CCTCACCCCCAGGTAACTATAGG + Intergenic
1005915248 6:30345479-30345501 CTCCGCCCCCAGGGATCCCTCGG + Exonic
1006943061 6:37765666-37765688 CCCCAGCCCCAGGTTTCCATTGG - Intergenic
1007831929 6:44645557-44645579 CACGACCCCCAGTTATTCTTTGG + Intergenic
1017773433 6:157661169-157661191 CACCACCCCCAGGTATCCATGGG - Intronic
1017999808 6:159569135-159569157 CACCACCTCCAGGTGTCAGTGGG + Intergenic
1018103879 6:160465122-160465144 CACCACCCCCAGGTACCCCAAGG - Intergenic
1019095340 6:169575097-169575119 CACCACCACCAGCTATCCTGGGG + Intronic
1026058682 7:67007237-67007259 TAACACCCCCAGGTATCCTTGGG - Intronic
1026719410 7:72817795-72817817 TAACACCCCCAGGTACCCTTTGG + Intronic
1029150732 7:98478580-98478602 CAGCACCCCCAGGTCTAAATCGG + Intergenic
1037609203 8:20462263-20462285 CACCACCCCCAGGGCTGCACAGG + Intergenic
1038411823 8:27364938-27364960 GACTACCCACAGGTATGCATAGG - Intronic
1038424252 8:27454266-27454288 CACCACCACCACGTAGCCCTCGG - Exonic
1039362002 8:36886620-36886642 CTCCACCCCAAGGTAAACATGGG - Intronic
1040006452 8:42625172-42625194 CACCACGCCCAGCCATCTATTGG - Intergenic
1043606481 8:82006803-82006825 CACCACCCACAGCTGTTCATGGG - Intergenic
1044716277 8:95102645-95102667 CACCTCCCTCAGGTACCCATGGG - Intronic
1044913456 8:97086939-97086961 AGCCACCTCCAGGTATCCTTAGG + Intronic
1049579482 8:143404807-143404829 CACCACCCACAGGGCTCCTTGGG - Intergenic
1050514067 9:6424166-6424188 CAGCTCTCCCAGGTATCCATAGG - Intronic
1051253008 9:15181117-15181139 CACCACCCCCAGCCCCCCATTGG - Intronic
1053143600 9:35697397-35697419 CCCCACCCCCAGCTACCCATAGG - Exonic
1055935589 9:81601554-81601576 CACAGCCCCCAGGTATTTATAGG + Intronic
1057445943 9:95114700-95114722 CTCCACCCGCAGATATCCCTCGG - Exonic
1062463476 9:136671409-136671431 GACCACCCCCAGCCATCCGTGGG - Intronic
1062494232 9:136824129-136824151 CCCCTCCCCCAGGTCTCAATTGG + Intronic
1203793491 EBV:163860-163882 CACCGCCCCCAGGTAGGCAGAGG + Intergenic
1188581421 X:31718491-31718513 CCCCACCTCCAAATATCCATTGG - Intronic
1194479309 X:94400895-94400917 CACCACCACCACTGATCCATAGG + Intergenic
1195756931 X:108207881-108207903 CATCATCCCTTGGTATCCATGGG - Intronic
1199571981 X:149275337-149275359 CAGCACAACCAGGCATCCATGGG - Intergenic
1199680052 X:150217943-150217965 CACCACCAGGAAGTATCCATGGG + Intergenic