ID: 1017774939

View in Genome Browser
Species Human (GRCh38)
Location 6:157673158-157673180
Sequence CTCACTCCTGCTGCCCATGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2530
Summary {0: 1, 1: 0, 2: 6, 3: 152, 4: 2371}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017774939_1017774947 21 Left 1017774939 6:157673158-157673180 CCTCCATGGGCAGCAGGAGTGAG 0: 1
1: 0
2: 6
3: 152
4: 2371
Right 1017774947 6:157673202-157673224 GACTTTCCCAGCCAATGCCACGG 0: 1
1: 0
2: 0
3: 16
4: 140
1017774939_1017774948 24 Left 1017774939 6:157673158-157673180 CCTCCATGGGCAGCAGGAGTGAG 0: 1
1: 0
2: 6
3: 152
4: 2371
Right 1017774948 6:157673205-157673227 TTTCCCAGCCAATGCCACGGTGG 0: 1
1: 0
2: 0
3: 6
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017774939 Original CRISPR CTCACTCCTGCTGCCCATGG AGG (reversed) Exonic
Too many off-targets to display for this crispr