ID: 1017780643

View in Genome Browser
Species Human (GRCh38)
Location 6:157712931-157712953
Sequence AGCTATAAGTGACATCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017780643_1017780646 -3 Left 1017780643 6:157712931-157712953 CCATCGTGATGTCACTTATAGCT No data
Right 1017780646 6:157712951-157712973 GCTCTCCTGGAGATGGCTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 320
1017780643_1017780648 26 Left 1017780643 6:157712931-157712953 CCATCGTGATGTCACTTATAGCT No data
Right 1017780648 6:157712980-157713002 GAGAACTAGAGCCCAGTCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 191
1017780643_1017780645 -10 Left 1017780643 6:157712931-157712953 CCATCGTGATGTCACTTATAGCT No data
Right 1017780645 6:157712944-157712966 ACTTATAGCTCTCCTGGAGATGG 0: 1
1: 0
2: 2
3: 11
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017780643 Original CRISPR AGCTATAAGTGACATCACGA TGG (reversed) Intronic