ID: 1017780643

View in Genome Browser
Species Human (GRCh38)
Location 6:157712931-157712953
Sequence AGCTATAAGTGACATCACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 75}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017780643_1017780648 26 Left 1017780643 6:157712931-157712953 CCATCGTGATGTCACTTATAGCT 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1017780648 6:157712980-157713002 GAGAACTAGAGCCCAGTCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 191
1017780643_1017780645 -10 Left 1017780643 6:157712931-157712953 CCATCGTGATGTCACTTATAGCT 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1017780645 6:157712944-157712966 ACTTATAGCTCTCCTGGAGATGG 0: 1
1: 0
2: 2
3: 11
4: 107
1017780643_1017780646 -3 Left 1017780643 6:157712931-157712953 CCATCGTGATGTCACTTATAGCT 0: 1
1: 0
2: 1
3: 4
4: 75
Right 1017780646 6:157712951-157712973 GCTCTCCTGGAGATGGCTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 320

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017780643 Original CRISPR AGCTATAAGTGACATCACGA TGG (reversed) Intronic
900977303 1:6025735-6025757 TGCTACAGGTGACAACACGAAGG - Intronic
911279809 1:95910340-95910362 AGCTATAAATGAAAGCACAAAGG - Intergenic
919156502 1:193772813-193772835 TGCTATAAGTGATATAACAATGG + Intergenic
921037475 1:211395430-211395452 AACTAGAAGTCACATCAGGAGGG + Intergenic
1062987027 10:1778676-1778698 AGCTCCCAGTAACATCACGATGG - Intergenic
1063182127 10:3612984-3613006 AGTTATAAGTGAGAACAAGAAGG - Intergenic
1071870986 10:89794456-89794478 AGATGTAAGTGAAATCACTAAGG + Intergenic
1072124459 10:92433082-92433104 AGATCTAAGTGAAATCACTAAGG - Intergenic
1073887656 10:108058763-108058785 AGCTCTAAGTAACATGAAGAAGG + Intergenic
1080391227 11:31848659-31848681 AGCTTTAAGTGAAAGCAGGAGGG + Intronic
1081932373 11:46880723-46880745 AGCTATAAAGGACATCACTGAGG + Intronic
1082755464 11:57071453-57071475 ACATATAAGTGAAATCACGTGGG - Intergenic
1085184711 11:74565827-74565849 AGGTTTAGGTGACATCATGAGGG + Intronic
1085297091 11:75437439-75437461 AGCTATAAGAGACATCAGCTGGG - Intronic
1088144830 11:106663803-106663825 TCCTATAAGTCACATCACGTAGG - Intergenic
1095450920 12:42329713-42329735 TGTTATAAGTGACATTAAGAAGG + Intronic
1097784220 12:63741018-63741040 CCCTAAAAATGACATCACGAAGG - Intergenic
1106883045 13:34152637-34152659 AGGTATTATTGACATCACTAGGG - Intergenic
1107700856 13:43046373-43046395 AGCTACAAGAGACATCTCGGTGG + Intronic
1109225259 13:59686332-59686354 AGGTGTAAGTGACATCTCTAAGG - Intronic
1110638196 13:77790775-77790797 AGCTATAAGTCTCATCACCCAGG - Intergenic
1112339133 13:98538011-98538033 AGCTACAAGTGACATCTACAAGG - Intronic
1115726214 14:36218923-36218945 TACTATAAGGGACATCATGATGG + Intergenic
1127460989 15:59198893-59198915 AGCTATAAGGGACATGACAGAGG - Intronic
1128832119 15:70779195-70779217 AGCTGTTAGTGACATTATGACGG + Intergenic
1130759829 15:86807351-86807373 AACTGTAAGAGACATCACGTTGG + Intronic
1135812908 16:25605925-25605947 AGCTATAAATGACACCAAAATGG - Intergenic
1141263232 16:82472648-82472670 ATGTATAAGTGACAACACGCAGG + Intergenic
1144347856 17:14366239-14366261 AGTTATAACTGAAAACACGAAGG - Intergenic
1144554641 17:16271180-16271202 AGCTTTAAGAGACATAATGAAGG - Intronic
1153309156 18:3661237-3661259 ACCTATAAGTGACATCATAGAGG - Intronic
1154944950 18:21153040-21153062 AGCTATAAAAGAAATCAAGAAGG - Intergenic
1156135903 18:34037139-34037161 AGCTGAAAGTGAAATCAAGAAGG + Intronic
932418468 2:71587522-71587544 AGCTATCAATGACCTTACGAGGG - Intronic
939411560 2:141833270-141833292 AACTATAAGAGACATCAGGCTGG + Intronic
941845994 2:170133818-170133840 ACCTATAAGTGAGAACACGTGGG - Intergenic
941900944 2:170677397-170677419 AGCTTAATGTGACATCATGATGG - Intergenic
944155326 2:196601580-196601602 TGCTATAAGTGGAATCACCAGGG - Intergenic
949625434 3:5861274-5861296 AACTATAAGTGACAGCAGTAAGG - Intergenic
956745321 3:72306494-72306516 AGCTATAAATAACATCAGGCTGG - Intergenic
956765786 3:72483086-72483108 AGCTAGAAATGACCTCAGGAGGG - Intergenic
957310946 3:78517944-78517966 AGCTGTAAGTGACATCTTCAGGG + Intergenic
958780108 3:98530835-98530857 ACCTATAAGTGACATCATGATGG - Intronic
974665871 4:64960864-64960886 AAATAAAAGTGACAACACGAGGG + Intergenic
975626476 4:76354183-76354205 AGCCATAAGCGCCATCAGGAAGG + Intronic
975660212 4:76681119-76681141 AACTGCAAGTGACATCACTAGGG - Intronic
976539332 4:86254979-86255001 ACATAAAAGTGACATCACCAAGG + Intronic
978566868 4:110092009-110092031 AGTTATAAGTGATAACAAGAAGG + Intronic
979296760 4:119041763-119041785 AGCTATATGTTACACTACGAAGG - Intronic
981307086 4:143257827-143257849 AGGTCTAAGTGACATCAGGGTGG - Intergenic
982112252 4:152067449-152067471 AGCTCTTAGTGCCATGACGAAGG - Intergenic
985873833 5:2580148-2580170 AGCAATAGGTGACTTTACGAAGG + Intergenic
992296157 5:75328760-75328782 ATTTATAAGTGATGTCACGAAGG - Intergenic
994447023 5:99889135-99889157 ACCTATAAGATACATCACAATGG - Intergenic
994663359 5:102679577-102679599 AGATATGATTGACATCACAATGG + Intergenic
998004070 5:138645858-138645880 AGCAAGAAGTGACTTCACCAAGG + Intronic
998473954 5:142405318-142405340 AGCTCTCAGTGACATCAGGAGGG + Intergenic
1001102722 5:168827554-168827576 AGCTCTAAGGGTAATCACGAGGG - Intronic
1001889161 5:175324630-175324652 AGGTCTAAGTGACATCATTAAGG - Intergenic
1005557571 6:27003007-27003029 AACCAGAAGTGACATCACTAAGG - Intergenic
1008095713 6:47337359-47337381 AGCTATAAATGTAATCACAAGGG + Intergenic
1008816736 6:55577762-55577784 AGATAAAAGTTACATCAGGAAGG + Intronic
1017780643 6:157712931-157712953 AGCTATAAGTGACATCACGATGG - Intronic
1018551213 6:165001107-165001129 AGCCAGAAGTGGCAACACGATGG - Intergenic
1021677070 7:23091156-23091178 AGCTTAAAGTGACATAAGGATGG + Intergenic
1022977266 7:35570239-35570261 AGCTGTAAATGAGATCACGAAGG + Intergenic
1023534223 7:41191182-41191204 AGGTTTAAGTGACATCATGAGGG + Intergenic
1026234242 7:68512124-68512146 AGCTAAAATGGACATTACGATGG + Intergenic
1030530425 7:110705779-110705801 ACTTATAAGTGACATAAAGATGG - Intronic
1036554507 8:9847151-9847173 AGCTATAACACTCATCACGAGGG - Intergenic
1044327869 8:90880905-90880927 AGCTATAAGTGAAAACTGGAAGG - Intronic
1045011399 8:97961937-97961959 AGCTATAGGTGACATTAGGGAGG - Intronic
1046321675 8:112585451-112585473 AGTCATAAGTGACAACACAAGGG - Intronic
1052686182 9:31759716-31759738 AGCTAAAAATGAAATCAAGAAGG - Intergenic
1052746869 9:32449685-32449707 AGCTATTAATGACATCAGGGTGG - Intronic
1055159767 9:73111793-73111815 AGCTACAACTTACATCACCAAGG - Intergenic
1062428055 9:136515115-136515137 GGCTATAACTGGCAGCACGATGG - Intronic
1188486646 X:30689359-30689381 AGCCATTAGTGACATCATCATGG - Intronic
1188736597 X:33725413-33725435 AGCTATAAGTCACAAAACAATGG - Intergenic
1195591933 X:106639543-106639565 AGCTATAAGTGAAGTCAGGAAGG + Exonic
1196611792 X:117723586-117723608 AGATAGAAGTGAGATCATGAAGG + Intergenic