ID: 1017780844

View in Genome Browser
Species Human (GRCh38)
Location 6:157714092-157714114
Sequence CCATAAGCAATAGGGGTAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017780844_1017780852 12 Left 1017780844 6:157714092-157714114 CCATTTACCCCTATTGCTTATGG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1017780852 6:157714127-157714149 GAAGAGATGTTCTATCTGCCAGG 0: 1
1: 0
2: 1
3: 9
4: 204
1017780844_1017780849 -10 Left 1017780844 6:157714092-157714114 CCATTTACCCCTATTGCTTATGG 0: 1
1: 0
2: 0
3: 10
4: 102
Right 1017780849 6:157714105-157714127 TTGCTTATGGAATTCAGCCCTGG 0: 1
1: 0
2: 1
3: 12
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017780844 Original CRISPR CCATAAGCAATAGGGGTAAA TGG (reversed) Intronic
904103415 1:28054100-28054122 CCATATGCTAGAGGGGTAAAGGG + Intronic
910240733 1:85083159-85083181 CAATAAGCAATAAGAATAAAGGG + Intronic
910686321 1:89920727-89920749 TCAGAAGCAATAGGGGAAAAAGG - Intronic
911075656 1:93871752-93871774 CCATACGGGATAGGGGTAAAAGG - Intronic
915418472 1:155760687-155760709 CAACAAGCAATAAGGGTACAAGG + Intronic
917687492 1:177432163-177432185 CCATTAGCAACGTGGGTAAAGGG - Intergenic
918966600 1:191358166-191358188 CCATCAGCAATATATGTAAAGGG - Intergenic
1069048579 10:63768514-63768536 CTATAAGCAAAAGGAGAAAATGG - Intergenic
1072735038 10:97873529-97873551 CCATAAGCAGTTGGGGAAAGAGG + Intronic
1079051090 11:17160412-17160434 AAATAAGCAAAAGGGCTAAATGG + Intronic
1079707961 11:23645251-23645273 CAATAGACAATAGGGTTAAAGGG - Intergenic
1080245675 11:30177105-30177127 CAATATACAATAGGGGTACAGGG + Intergenic
1087144905 11:94801456-94801478 CCATAAGCAATCGGGAAAAGCGG + Intronic
1088386816 11:109267640-109267662 ACAGAAGCAATAGGGTTAAGTGG - Intergenic
1088770351 11:113029537-113029559 CCAATAGCAACAGGGTTAAAGGG + Intronic
1100151644 12:91744922-91744944 GAATAAGCACTAGGGGTAGAAGG + Intergenic
1100699079 12:97127158-97127180 CCATAAGCAAGAGAGGCAAGGGG + Intergenic
1103145306 12:118590294-118590316 CCATATGCACTAGGGATACAAGG - Intergenic
1104438105 12:128772167-128772189 CCATAATCAAGAGGAGTGAATGG - Intergenic
1104503988 12:129313184-129313206 CCATAAGCAATTTGGGTACATGG + Intronic
1104536803 12:129625174-129625196 CCAAAAGGAAAATGGGTAAAAGG - Intronic
1107193854 13:37623295-37623317 CCACAACCATTAGGGGAAAAAGG - Intergenic
1109360289 13:61286348-61286370 CCAGCAGCCATAGGGGCAAAAGG + Intergenic
1110366074 13:74687374-74687396 GCATACAAAATAGGGGTAAATGG + Intergenic
1114936859 14:27549243-27549265 CCAGAAACAATGGGGGTACAAGG - Intergenic
1115373295 14:32643949-32643971 CTACAAGAAATAGGGGGAAAAGG - Intronic
1115863078 14:37711522-37711544 CCAGGAGCAATAGGGGAAACAGG - Intronic
1116328760 14:43569038-43569060 AAATAAATAATAGGGGTAAATGG - Intergenic
1116375144 14:44189799-44189821 GCATGAGCAATAAGGCTAAATGG + Intergenic
1118553885 14:66991000-66991022 CCTTAATCAATAGTGGTACAGGG - Intronic
1119209427 14:72819352-72819374 CCAAAAGAAATGGGGGAAAATGG + Intronic
1132826717 16:1908906-1908928 CTAGAAGCAATAAGGGGAAAAGG + Intergenic
1133531317 16:6657637-6657659 CCAGAAGCATTTGGGTTAAATGG - Intronic
1134068463 16:11245616-11245638 CCATGAGAAATTGGGGTAAATGG + Intergenic
1134775973 16:16853926-16853948 CCATAATAAATAGAAGTAAATGG + Intergenic
1134814667 16:17195993-17196015 CCATAAGACAGAGGGATAAACGG - Intronic
1135829890 16:25763711-25763733 CCAAAAGCAAGAGGGGCAAGAGG + Intronic
1140940700 16:79719346-79719368 CCATCAGAAATAGGGGCAAAGGG + Intergenic
1142009941 16:87708859-87708881 CCAGCAGCAGTTGGGGTAAAGGG + Intronic
1143303970 17:5931502-5931524 AGATAAGTAATAGGGGTAAACGG - Intronic
1144135075 17:12287065-12287087 CCATAAGCATTAGGCGAACAGGG - Intergenic
1144329067 17:14207849-14207871 TCATACGCAATGGGGGTGAAGGG - Exonic
1144999118 17:19291112-19291134 CCAGAAGAAATTGGGGCAAAAGG + Intronic
1152826048 17:82465528-82465550 CCAGAAGCCATGGGGGTGAATGG - Intronic
1156061105 18:33077330-33077352 ACATATGCAATTGGGATAAAAGG - Intronic
1156092885 18:33493131-33493153 CTATAAGCAATAGTGGGGAAGGG - Intergenic
1156721907 18:40080436-40080458 CCATAATCAAAAGGTGAAAAAGG + Intergenic
1159002607 18:62987478-62987500 CCATTAGCAATGAGGGTAGAAGG + Intergenic
1160251407 18:77206804-77206826 CCCTAAGCTACAGGGCTAAAAGG - Intergenic
1164010364 19:21198183-21198205 TCATAATAAACAGGGGTAAAAGG + Intergenic
1164310857 19:24045088-24045110 CCTTAAGGGAGAGGGGTAAAGGG - Intronic
1166346216 19:42167789-42167811 CCATAGGCAATATGGGCAATGGG - Intronic
926850512 2:17192294-17192316 CCATATCCAATAGGGATAATAGG - Intergenic
932095511 2:68844829-68844851 CCATAATCAATCTGGCTAAATGG + Intergenic
932382548 2:71298661-71298683 CCATAAGCAAGACAGGAAAATGG + Intronic
933495400 2:83044555-83044577 CTATAAACATAAGGGGTAAAAGG + Intergenic
940367905 2:152869262-152869284 CTATAAGCAATACGAGTGAAGGG - Intergenic
945136845 2:206638731-206638753 CAATAAGCAACAGGGGTAAGAGG - Intergenic
945399422 2:209362533-209362555 CCAAAAGTAAGAGGGGTACAGGG + Intergenic
946892657 2:224294234-224294256 CCATTAGCATTCGGGGGAAAAGG + Intergenic
1171484214 20:25475962-25475984 CCATTAGCAACAGGGGTCAGTGG + Intronic
1171988006 20:31674313-31674335 CCATCAGCTATATGGGTTAATGG - Intronic
1173004784 20:39131644-39131666 CCATAAGCAATAGGGAGCCATGG - Intergenic
1180021511 21:45131278-45131300 CCATAAGCAATAGAGCTGAGTGG + Intronic
955485801 3:59433410-59433432 CCATAAGCAAGCTGGGTGAAAGG - Intergenic
957245434 3:77710543-77710565 ACATAAGAAACAGGGCTAAAGGG + Intergenic
958622434 3:96578439-96578461 CCAAAAGGAAAAGGGGAAAAAGG + Intergenic
975266687 4:72377378-72377400 CCAAGAGAAATAGGGGAAAACGG + Intronic
975512241 4:75206849-75206871 CCAAAGGCAATAGGGGCAGAGGG - Intergenic
976208510 4:82644293-82644315 GCAGAAGCAAGATGGGTAAAGGG - Intronic
977151592 4:93519855-93519877 CCAAGAGCAATATGGGGAAAGGG + Intronic
977419702 4:96783278-96783300 TCATAACTAATAGAGGTAAATGG - Intergenic
981657312 4:147126092-147126114 TGATAAGAAATTGGGGTAAAAGG + Intergenic
982505436 4:156211357-156211379 CCATAATCACTAGGTGTCAAGGG - Intergenic
986468574 5:8051227-8051249 CCATAAACTGTGGGGGTAAAGGG - Intergenic
987460885 5:18208340-18208362 CCATAAGTAAAATGGGTAATGGG + Intergenic
990776884 5:59313287-59313309 CCATAAGCAATATAAATAAAGGG - Intronic
995433872 5:112113565-112113587 CCAAAAGCATTATGGGTAATTGG - Intergenic
997023627 5:130032078-130032100 CAATAAGCAATAGAGGAATAGGG - Intronic
1001097423 5:168786616-168786638 CCGTAAGAGAAAGGGGTAAAAGG - Intronic
1005340310 6:24837758-24837780 CCATAAGCAATCTGGGGACATGG - Intronic
1008737671 6:54565617-54565639 TCATTAGGAATAGGGCTAAATGG - Intergenic
1012831166 6:104204875-104204897 TCTTAAGTTATAGGGGTAAAAGG - Intergenic
1016177861 6:141102051-141102073 TCCTAAGAAATTGGGGTAAATGG - Intergenic
1016360568 6:143263138-143263160 CCATAAGCAATACTGGGGAAAGG - Intronic
1017492376 6:154955825-154955847 CCATAAGAAATAGGGCTTCATGG - Intronic
1017780844 6:157714092-157714114 CCATAAGCAATAGGGGTAAATGG - Intronic
1019091779 6:169541705-169541727 CCATAAGCAAATCTGGTAAACGG + Intronic
1023159218 7:37281358-37281380 CCATAAGTTATTGGGGTAACAGG - Intronic
1027432139 7:78125209-78125231 ACAGAAGCATTAGGAGTAAAAGG - Intronic
1031593111 7:123618074-123618096 CCAGAAGCAAGAGGTGGAAAGGG + Intronic
1031632464 7:124061228-124061250 TCAGAAACATTAGGGGTAAAAGG + Intergenic
1033416112 7:141162511-141162533 CCATAGGCAGTAGTGCTAAAAGG - Intronic
1033445915 7:141422135-141422157 CCAGAAGTAATAGGGTTAACAGG - Intronic
1045903680 8:107316195-107316217 CCATATTAAACAGGGGTAAATGG - Intronic
1049396500 8:142403391-142403413 CCATATGCAAAACGGGGAAACGG - Intergenic
1055743616 9:79417541-79417563 GCATAAGCAACAGGGGTACTAGG - Intergenic
1056043073 9:82687713-82687735 CCATCAGCTATAGGGGAAGAGGG + Intergenic
1057451977 9:95171966-95171988 CCATCAGCAAAAAGAGTAAATGG - Intronic
1187631489 X:21177631-21177653 ACATTAGCAATATGGGTAGAAGG - Intergenic
1188557533 X:31429251-31429273 CCATGAGCAATACTGATAAATGG - Intronic
1188593418 X:31866698-31866720 CCAGAAACATTAGGGGTAAAGGG + Intronic
1189000463 X:36938548-36938570 CCATAAGGAGAAAGGGTAAAAGG + Intergenic
1189327337 X:40120758-40120780 CGATAAGCAATAAAGGTAAGAGG + Intronic
1190297073 X:49033982-49034004 CCACAAGCCATAGGGGGAAAGGG + Intronic
1190972764 X:55367825-55367847 GCATAAGCAATACAGGTACATGG + Intergenic
1198323845 X:135546985-135547007 CCTTAAGCAACAGAGTTAAAAGG - Intronic
1200353533 X:155524723-155524745 CAATAAGCAATAAGGGTTGAGGG + Intronic
1200693986 Y:6340292-6340314 CAATAAGCAATAGTGTTCAAGGG - Intergenic
1200712018 Y:6493652-6493674 CAATAAGCAATACTGTTAAAGGG + Intergenic
1200952499 Y:8913500-8913522 CAATAAGCAATACTGTTAAAGGG - Intergenic
1201021913 Y:9668320-9668342 CAATAAGCAATACTGTTAAAGGG - Intergenic
1201041291 Y:9834427-9834449 CAATAAGCAATAGTGTTCAAGGG + Intergenic