ID: 1017781177

View in Genome Browser
Species Human (GRCh38)
Location 6:157716497-157716519
Sequence CCAGTGCCACAGGAAGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017781177_1017781188 30 Left 1017781177 6:157716497-157716519 CCACGTTCTTCCTGTGGCACTGG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1017781188 6:157716550-157716572 CAGCAAGAGAGAAGTGGTCAAGG 0: 1
1: 0
2: 2
3: 34
4: 356
1017781177_1017781184 3 Left 1017781177 6:157716497-157716519 CCACGTTCTTCCTGTGGCACTGG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1017781184 6:157716523-157716545 GCGAGCCGTTGTCTGCTACGGGG 0: 1
1: 0
2: 0
3: 1
4: 14
1017781177_1017781183 2 Left 1017781177 6:157716497-157716519 CCACGTTCTTCCTGTGGCACTGG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1017781183 6:157716522-157716544 GGCGAGCCGTTGTCTGCTACGGG No data
1017781177_1017781182 1 Left 1017781177 6:157716497-157716519 CCACGTTCTTCCTGTGGCACTGG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1017781182 6:157716521-157716543 AGGCGAGCCGTTGTCTGCTACGG No data
1017781177_1017781186 24 Left 1017781177 6:157716497-157716519 CCACGTTCTTCCTGTGGCACTGG 0: 1
1: 0
2: 1
3: 16
4: 178
Right 1017781186 6:157716544-157716566 GGAGACCAGCAAGAGAGAAGTGG 0: 1
1: 0
2: 3
3: 75
4: 535

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017781177 Original CRISPR CCAGTGCCACAGGAAGAACG TGG (reversed) Intronic
902182734 1:14701808-14701830 ACAAAGCCACAGGAAGAAGGTGG + Intronic
903918590 1:26783031-26783053 CAAGTGCCACAGGAAAAATAAGG - Intergenic
905293604 1:36940251-36940273 CCAGGGCCACAGGACGGAGGTGG - Intronic
907174590 1:52507061-52507083 CCAGTGTCCCATGAAGCACGAGG + Intronic
907460883 1:54604799-54604821 CCAGTGGCACAGGCAGGAAGTGG - Intronic
916739854 1:167638495-167638517 CCAGAGCAAGAGGAAGAACAGGG - Intronic
918526195 1:185467402-185467424 CCAGTGGCAGCGGAACAACGTGG - Intergenic
920585310 1:207153308-207153330 CCTGTCCCACAGGAAGCACTGGG - Intergenic
1063437634 10:6047306-6047328 CCTGTGCCACACTCAGAACGCGG + Intronic
1063942812 10:11148083-11148105 CCAGTCCGGCAAGAAGAACGTGG + Intronic
1066177847 10:32927894-32927916 CCAGTGACAGAGGAACAAGGTGG + Intronic
1066616504 10:37300366-37300388 TCAGGGCCCCAGGAAGAAGGGGG - Intronic
1069545012 10:69321429-69321451 CCAGCCCCACAGGAAGAACAGGG - Intronic
1070489375 10:76962192-76962214 CCAGTGCCACCGAAGGAACTGGG - Intronic
1071283622 10:84124929-84124951 CCAGTGTCTCAAGAAGAACTAGG - Intergenic
1077206499 11:1347078-1347100 CCAGTACCAAAGGAAGCACAGGG + Intergenic
1080026954 11:27625440-27625462 CCACTGCTCCAGGAAGAACTGGG - Intergenic
1080271487 11:30455273-30455295 CCAGTGCCTCAGCAGGAATGGGG - Intronic
1081704858 11:45176524-45176546 TCAGTGCCACAGGACGGATGGGG + Intronic
1081998486 11:47378966-47378988 GCAGGGCCACAGGAAGAGCCAGG - Intergenic
1083046959 11:59745380-59745402 CCAGTGCTTCAGGATGCACGTGG - Intronic
1088638146 11:111844484-111844506 CCATTTCCATAGGAAGAATGTGG + Intronic
1092007726 12:5083694-5083716 CCAGTCCCACAGCAAGTAAGTGG - Intergenic
1094488647 12:30945021-30945043 CCAGTGCAACAGGAAGCACTGGG - Intronic
1095886102 12:47190232-47190254 CCAGCACCATGGGAAGAACGGGG - Intronic
1096391025 12:51229154-51229176 CCGGTGCAACAGGGAGAAGGTGG + Intergenic
1100754571 12:97736199-97736221 CCAGTGGCACAGGAAGAATGTGG + Intergenic
1101557406 12:105823171-105823193 CCAGGGACCCAGGAAGAACAAGG + Intergenic
1102507382 12:113392273-113392295 CCTGTACCACAGGAAGCAGGTGG - Intergenic
1102605696 12:114065757-114065779 CCAGTGTCTCAAGAAGAACTAGG + Intergenic
1103597054 12:122030391-122030413 GCAGTGACACAGGAGGAACCTGG + Intronic
1105611716 13:21974720-21974742 CCAGTGCCAGAGGGAGATCCTGG - Intergenic
1106042942 13:26111241-26111263 CCAGTGCTAGAGGAGGAAGGAGG - Intergenic
1106954805 13:34924710-34924732 GGAGTACCACAGGTAGAACGAGG + Intergenic
1107983909 13:45758488-45758510 CCATTGCCTCAGGCAGAACAGGG + Intergenic
1110079056 13:71287532-71287554 CCAATGCCACAGGATGAAGGAGG + Intergenic
1113524827 13:110966666-110966688 CCAGTGTCCCAAGAAGAACTAGG + Intergenic
1114695933 14:24627834-24627856 CCAGGGCCACAGGAAGAATCAGG - Intergenic
1114847647 14:26343215-26343237 CCACTGCCAGAGGCAGAACGTGG + Intergenic
1120829366 14:88984519-88984541 TCTGTGCCCCAGGAAGAAGGTGG - Intergenic
1122886162 14:104711363-104711385 CCAGTGCTGCAGGAAGGAAGGGG - Intronic
1123483873 15:20665903-20665925 CCAGTGCCAAAGAAACAACTGGG + Intergenic
1124169505 15:27360264-27360286 CCAGTGCCTCAGGCAGAGTGGGG - Intronic
1125390428 15:39186616-39186638 CCAGGAGCAGAGGAAGAACGGGG - Intergenic
1125471655 15:40010370-40010392 TCAGTCCCACAGGAAGGAGGTGG - Intronic
1125483887 15:40099029-40099051 ACAGTGCCAGGGGAAGAATGAGG - Intronic
1126420269 15:48465085-48465107 CCAGTAACACAGGATGAACAAGG + Intronic
1128383968 15:67134122-67134144 CGAGTGCCACAGGGAGAAAGTGG + Intronic
1131223568 15:90605656-90605678 ACAGTGCAACAGAAAGAGCGTGG - Intronic
1132524137 16:406002-406024 CCAGCCCCACAGGGAGAAGGGGG + Intronic
1135054839 16:19222642-19222664 CCAAAGCCACAGCAAGAAAGTGG - Intronic
1137825784 16:51493689-51493711 CCAGGGCCACAGGGAGCAGGTGG + Intergenic
1141469051 16:84226120-84226142 CCCTTGCCACAGGCAGAGCGAGG + Intronic
1142308306 16:89298061-89298083 CCAGTTCCACAGGAAGCCTGTGG + Intronic
1146623963 17:34421902-34421924 GCAGTCCCACAGGAAGTAAGCGG - Intergenic
1146923218 17:36727561-36727583 CCAGTGGGACAGGAAGGAAGAGG + Intergenic
1150001599 17:61443898-61443920 CGAGAGCCACAGTGAGAACGAGG + Intergenic
1150021084 17:61613922-61613944 CCAGTTCCATTGGAAGAAAGTGG + Intergenic
1150942478 17:69707646-69707668 CCAGAGCCACAGGCAGGAAGCGG + Intergenic
1151283615 17:73094198-73094220 CTAGTTCCACTGGAAGAAAGAGG - Intergenic
1151558814 17:74860284-74860306 CCCGGGCCACAGGAAAATCGAGG - Intronic
1152381184 17:79943015-79943037 CCGGAGGCACAGGAAGGACGGGG + Intronic
1152755477 17:82085310-82085332 CCGGCGGCACAGGAAGAGCGTGG + Exonic
1153731114 18:8012936-8012958 CCAGTGCAAGAGGCAGCACGAGG - Intronic
1153826749 18:8882116-8882138 CCAGTGTCTCAAGAAGAACTAGG - Intergenic
1154487674 18:14888709-14888731 TTATTGCCATAGGAAGAACGTGG + Intergenic
1156425560 18:37008146-37008168 GCAGTGCCACAAGAGGAACCAGG + Intronic
1162157900 19:8692188-8692210 TCAGGGCCATAGGAAGAACTTGG + Intergenic
1162487239 19:10968693-10968715 CCAGTGGCTCAGGAAGCAGGTGG + Intronic
1163266787 19:16226806-16226828 CCAGTGCCCCAGGCAGAGCAGGG - Intronic
1163758688 19:19121370-19121392 CCAGAGCCACAGGATGAACAGGG + Exonic
1164632825 19:29772972-29772994 TCAGAGCCACAGGAAGATGGGGG - Intergenic
1165477567 19:36040007-36040029 CCAGCGCCACTGGAAGCAGGAGG + Exonic
1165595908 19:37011181-37011203 CCAGTCCAACAGGGAGAAAGTGG + Intronic
1167106003 19:47430146-47430168 CCAGAGGCCCAGGAAGAGCGCGG + Exonic
1167347434 19:48955239-48955261 CCAGTGCCAGAGGCAGGAAGTGG - Intronic
1167523177 19:49969161-49969183 CCAGCTCCACAGGGAGAAGGGGG - Intergenic
1168351304 19:55677712-55677734 CCAGGGCGGCAGGAAGAACCGGG - Exonic
925105716 2:1289317-1289339 CCAGTGCCCCAGGAAAGATGAGG - Intronic
925406696 2:3610376-3610398 CCAGAGCACCAGGAAGAAGGCGG - Intronic
926899517 2:17735301-17735323 GCAGTGCCACAGTAAGAATTTGG + Intronic
927562356 2:24083041-24083063 CCAGGGACACTGGAAGATCGGGG - Exonic
928200774 2:29246426-29246448 GCAGTGCCATGAGAAGAACGTGG - Intronic
928339302 2:30427681-30427703 CCAGTGTGACAGGAAGAGAGGGG - Intergenic
928783484 2:34853756-34853778 CCAGTGCCACAAGAAGCTCTCGG - Intergenic
935128757 2:100245819-100245841 CCAGTCCCCCAGGCAGAACATGG + Intergenic
935254734 2:101299721-101299743 CCATTACCACACAAAGAACGTGG - Intronic
939422491 2:141991939-141991961 CCAGTCCCACAGGAATACCAGGG - Intronic
940162845 2:150732008-150732030 CCAGTGCCATAGGTAGAAATTGG + Intergenic
946396038 2:219444232-219444254 CCAGTACCCCAGGAACAAAGAGG - Intronic
947498442 2:230655747-230655769 CATTTGCCACAGGAAGAAAGGGG - Intergenic
947556661 2:231099308-231099330 CCAGTGTCTCAGGAAGAACTAGG - Intronic
947743064 2:232493728-232493750 CCAGTGCCACAGACAGAAAATGG - Intergenic
947854108 2:233311669-233311691 CCACTGCAACAGGAAGGACAGGG - Intronic
1168823486 20:793077-793099 CCAGTGTCTCAAGAAGAACTAGG + Intergenic
1169316294 20:4593310-4593332 ACAGGGGCACAGGAAGAAGGAGG - Intergenic
1169702890 20:8467986-8468008 CCACTGCTACAGGAAAAATGTGG + Intronic
1178285341 21:31321124-31321146 CCTGGGCCACAGAAAGAAGGGGG + Intronic
1178402799 21:32301399-32301421 CCAGAGCAAGAGGAAGAAAGAGG - Intronic
1179524103 21:41964491-41964513 CCAGAGCTACAGGAGGAAGGCGG - Intergenic
1181459538 22:23078051-23078073 ACAGGGCCACAGGAAGCAAGAGG - Intronic
1182350881 22:29698812-29698834 CAAGTGCCCCAGGAAGAGGGAGG - Intergenic
1182524244 22:30905825-30905847 CCACCGCCACAGGGAGAACGCGG + Exonic
1182761932 22:32729388-32729410 CCAGTGGGAGAGGAAGAAGGGGG + Intronic
1182964354 22:34507310-34507332 CCACTGCCACATGAAGTACAGGG + Intergenic
1183108396 22:35630576-35630598 GCAATGCCACAGGAAGAACCAGG - Intronic
1183950610 22:41350616-41350638 TCAGAGCAACAGGAAGAATGGGG + Intronic
1185357558 22:50383291-50383313 CCAGGACCACAGGAAAAACCAGG - Intronic
949618901 3:5787923-5787945 CAAGTTCCACTGGAAGCACGTGG + Intergenic
950257922 3:11521225-11521247 CCAGTGCCACAGGAGCACAGGGG + Intronic
950846808 3:16022945-16022967 CCAGTGTCTCAAGAAGAACTAGG - Intergenic
952263344 3:31761969-31761991 GCAGTGCTATTGGAAGAACGAGG + Intronic
953732916 3:45465377-45465399 CCAGTGCCACAGGGACCAGGTGG + Intronic
954385202 3:50240473-50240495 CCAGTGCCATAGGTGGAACTGGG - Intronic
959126070 3:102291385-102291407 CCACTGCCACAGGAAGGGAGAGG + Intronic
960031832 3:113061799-113061821 CCAGAGCCAGAGAAAGAACGAGG - Intergenic
961751061 3:129095197-129095219 CCAGTGGCACAGGCTGAACATGG + Intronic
962391853 3:134978780-134978802 CCAGAGCCACAGGAGCAACCTGG - Intronic
964636872 3:158867449-158867471 CCGGTACCACAGGGAGAACCTGG - Intergenic
967882194 3:194309530-194309552 TCAGGACCACAGGAAGAAGGAGG - Intergenic
969063271 4:4456528-4456550 CCAAGGCCACAGGAAGCAGGAGG - Intronic
969170253 4:5356509-5356531 CGAGTGCCCCAGGAAGAGCTGGG + Intronic
969458429 4:7314230-7314252 TCAGTGGCACACGGAGAACGAGG + Intronic
975533856 4:75428181-75428203 CCAGTGACACTTGAACAACGTGG + Intergenic
976850431 4:89539088-89539110 CCCGAGTCACAGGAAGAACTAGG + Intergenic
978582339 4:110244669-110244691 CCATTGCCACAGGAAGAGATAGG + Intergenic
980516324 4:133867158-133867180 CCAGGCCCACAGGGAGAACTAGG - Intergenic
981278379 4:142928531-142928553 CCAGTGCCAAAAGAAAAAGGAGG + Intergenic
981737122 4:147964373-147964395 CAAGAGGCAGAGGAAGAACGGGG - Intronic
984726654 4:183028400-183028422 CCAGTGCCACAGGTGGGAGGGGG - Intergenic
984937057 4:184898576-184898598 CCAGGGCCACAGGAAGCAGCTGG + Intergenic
992750851 5:79859271-79859293 CCAGTGCCACATCATGAAAGGGG + Intergenic
992906872 5:81355770-81355792 CCAGCCCCACAGGAAGCAGGAGG - Intronic
994016251 5:94969576-94969598 TCAGTGTCACAAGAAGAAGGAGG + Intronic
997657853 5:135568620-135568642 CTAGAGCCACAGGCAGGACGAGG + Intergenic
998955769 5:147436691-147436713 CCAGTGTGACAGGAAGAATATGG + Intronic
1002013139 5:176300775-176300797 CCAGTGCCACAGAAATAAAAAGG + Intronic
1002214697 5:177621973-177621995 CCAGTGCCACAGAAATAAAAAGG - Intergenic
1002271530 5:178075680-178075702 CCAGTGCAACAGGAAGCCCTTGG + Intergenic
1002423861 5:179164563-179164585 CAAGTGCCAGAGGAAGAGCGTGG + Intronic
1002792368 6:445815-445837 CCAGTGTCACAGGAAGCTTGGGG + Intergenic
1004015932 6:11731980-11732002 CCACTGCCTCAGGGAGAACTAGG + Intronic
1004989798 6:21124633-21124655 CCATTGCCACAAAGAGAACGAGG - Intronic
1008021707 6:46585914-46585936 CCAATGGGACAGGATGAACGGGG + Intronic
1011854595 6:91673638-91673660 CCGGTGCCACAAGCAGAACTGGG + Intergenic
1012096828 6:94972763-94972785 CCAGTGCAGCTGGAAGAAGGTGG - Intergenic
1012760283 6:103292947-103292969 CCAGTGCCATATGAATTACGAGG - Intergenic
1013259696 6:108429418-108429440 TCACTACCACAGGAAGAACACGG + Intronic
1017781177 6:157716497-157716519 CCAGTGCCACAGGAAGAACGTGG - Intronic
1019180499 6:170184593-170184615 CCAGGGCCACAGGAAGCTGGTGG - Intergenic
1019191171 6:170251747-170251769 ACAGTGCCACAGGAACACCTTGG - Intergenic
1019352046 7:558945-558967 CCAGTGCTCCAGGGAGAACCTGG + Intronic
1020560954 7:9728219-9728241 CCAAGGCCACAGGAAGACGGAGG - Intergenic
1021295014 7:18893942-18893964 ACAGTGCCAAAGGAAGAAGAAGG + Intronic
1022805195 7:33814428-33814450 CCAGTGACACAGAGAGAACTGGG - Intergenic
1023234318 7:38067887-38067909 CCTGAGCCACAGGAAGACCAAGG - Intergenic
1024160098 7:46664946-46664968 CCAGAGCCACAGATAGAAAGTGG + Intergenic
1024178515 7:46864244-46864266 CCACTGACACAGGAAGTAGGGGG - Intergenic
1029202133 7:98846264-98846286 CTAGAGCCAGAGGAGGAACGTGG - Intergenic
1030160999 7:106508479-106508501 GCAGTGGCAGAGGAAGAAGGGGG + Intergenic
1033046412 7:137966416-137966438 CCAGTGGCTCAGGGAGAAGGAGG + Intronic
1034281149 7:149855406-149855428 CCCATGCCATAGGAAGAAAGGGG + Intronic
1034934134 7:155187675-155187697 CCAGTGCCACTGAAAGAAGGGGG + Intergenic
1036617951 8:10403428-10403450 CCAGGGCCACAGGAAGGGAGAGG + Intronic
1037013975 8:13879910-13879932 CCAGTGCCAAAGCCAGAACTAGG - Intergenic
1037886279 8:22598138-22598160 CCAGAGCCACTGGAAGGAAGTGG - Intronic
1039552032 8:38450393-38450415 CCAGTGGCCCCGGAGGAACGAGG + Intronic
1041241982 8:55855990-55856012 CCAGTGGCAAAAGAAGAAAGAGG + Intergenic
1042088288 8:65132041-65132063 CCAGTGTCTCAAGAAGAACTAGG - Intergenic
1043561558 8:81499668-81499690 CCAGTGCCAGAGAGAGAATGAGG - Intergenic
1043777081 8:84283457-84283479 CCAGCATCACAGGAAGAAAGAGG - Intronic
1047337680 8:123952239-123952261 CCAGTGACACAGTTAGAAAGTGG + Intronic
1047522808 8:125608470-125608492 CAAGTGCAACAGGAAGGAAGGGG + Intergenic
1048019053 8:130521492-130521514 CCAGAGCCACAGGAGGGAAGTGG + Intergenic
1048036569 8:130682928-130682950 GCAGAGCCACAGGGAGCACGGGG - Intergenic
1048436320 8:134421850-134421872 CAAGTGATACAGGAAGAAAGAGG - Intergenic
1049059547 8:140265540-140265562 TCTGTGCCACAGGAAGGATGGGG - Intronic
1049405818 8:142451446-142451468 CCAGACCCGGAGGAAGAACGGGG - Intronic
1050362142 9:4840266-4840288 CAAGTCCAACAGGTAGAACGAGG - Intronic
1055475232 9:76656838-76656860 TCAAAGCCACAGGAAGAATGTGG - Intronic
1055587511 9:77770679-77770701 CCAGTCCCAGAGCAAGAACTCGG + Intronic
1058721902 9:107772176-107772198 CCAGTTCCACAGGCAGTACAGGG + Intergenic
1059287099 9:113183505-113183527 CCAGAGCCACAGAATGAATGAGG + Intronic
1060775619 9:126371570-126371592 CCTGTGCCACAGGTAGAATGAGG + Intronic
1061250029 9:129421168-129421190 CCAGTGACACAGAAAGACCAGGG - Intergenic
1061416704 9:130451102-130451124 CCAGGGCCACAGGAGGCATGTGG + Intronic
1061815093 9:133189947-133189969 CCAGTTCCACAGCCAGAACGCGG - Intergenic
1062027084 9:134345511-134345533 CCAAGGCCACAGGCAGGACGGGG + Intronic
1062050934 9:134446706-134446728 CCAGCCCCCCAGGAAGAACCTGG - Intergenic
1062343281 9:136103313-136103335 CCAGGGCCACTGGAAGAAGGTGG - Intergenic
1194145683 X:90259230-90259252 CCAGTGCCAAAAGCAGAAGGGGG - Intergenic
1199637391 X:149826486-149826508 CCAGTGTCTCAAGAAGAACTAGG + Intergenic
1199713750 X:150491345-150491367 ACAGTGCCACAGGATTAACCTGG + Intronic
1200090371 X:153633149-153633171 ACAAGGCCACAGAAAGAACGAGG + Intergenic
1200491434 Y:3828525-3828547 CCAGTGCCAAAAGCAGAAGGGGG - Intergenic
1202059367 Y:20869710-20869732 CCTGTGCCACAGGAAGGTCTAGG + Intergenic