ID: 1017783342

View in Genome Browser
Species Human (GRCh38)
Location 6:157733630-157733652
Sequence GGCAGCTAGGACCATGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017783335_1017783342 5 Left 1017783335 6:157733602-157733624 CCCAGCTTCAGCTTACAGGCCTC 0: 1
1: 0
2: 1
3: 19
4: 208
Right 1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG 0: 1
1: 1
2: 1
3: 15
4: 184
1017783334_1017783342 6 Left 1017783334 6:157733601-157733623 CCCCAGCTTCAGCTTACAGGCCT 0: 1
1: 0
2: 0
3: 22
4: 229
Right 1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG 0: 1
1: 1
2: 1
3: 15
4: 184
1017783336_1017783342 4 Left 1017783336 6:157733603-157733625 CCAGCTTCAGCTTACAGGCCTCT 0: 1
1: 0
2: 3
3: 26
4: 281
Right 1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG 0: 1
1: 1
2: 1
3: 15
4: 184
1017783332_1017783342 15 Left 1017783332 6:157733592-157733614 CCTAGGAGGCCCCAGCTTCAGCT 0: 1
1: 0
2: 3
3: 29
4: 446
Right 1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG 0: 1
1: 1
2: 1
3: 15
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017783342 Original CRISPR GGCAGCTAGGACCATGGTGA GGG Intronic
900806230 1:4769889-4769911 AGCAGCTATGACCATGATGAGGG - Exonic
902938692 1:19783926-19783948 GTCAGCTCAGACCATGGTGGTGG + Intronic
902969171 1:20034213-20034235 TTCAGCTAGGTCCTTGGTGAAGG + Intronic
903142535 1:21347581-21347603 AGCAGTTGGGAGCATGGTGAAGG + Intergenic
906559963 1:46749082-46749104 TGCTGCTGGGACCAAGGTGAGGG - Intergenic
908523641 1:64967320-64967342 GGCAGCTCGGACCGTGTTGCCGG - Intergenic
909495358 1:76271799-76271821 GGCAGCTTGGAGCAGGGTGGTGG + Intronic
915068304 1:153244488-153244510 GGAAGTTATGATCATGGTGATGG + Intergenic
917222514 1:172747179-172747201 GGCTGTCAGGAGCATGGTGACGG - Intergenic
917453657 1:175167694-175167716 GGCAGCTGGGCCAAGGGTGATGG + Intronic
918043472 1:180927183-180927205 CCCAGTCAGGACCATGGTGAGGG + Intronic
918057670 1:181036179-181036201 GGGAGCTAGAACCATGAAGAAGG - Intronic
920950984 1:210571419-210571441 GGAAGGCAGGACCATGGTGTGGG + Intronic
921063783 1:211608439-211608461 AGTAGCTAGGGCCAGGGTGATGG - Intergenic
923227902 1:231956375-231956397 GTCAGCCATGACCCTGGTGATGG + Intronic
1062894306 10:1091136-1091158 GGCAGGCAGGCACATGGTGACGG - Intronic
1064554857 10:16538084-16538106 GGAAGCTGGGACCAAGGTGCCGG - Intergenic
1067177333 10:43959250-43959272 GGCAGCTGGGTCCCTGGTGGAGG + Intergenic
1067534877 10:47101678-47101700 GGCAGCTAGCAAGATGGTCATGG - Intergenic
1068696500 10:59973063-59973085 AGCAGCTTGGACTAGGGTGATGG + Intergenic
1069558731 10:69414998-69415020 GGCACCCTGGTCCATGGTGACGG + Exonic
1070763867 10:79045181-79045203 GGCAGCTCGGACCAGGAGGAGGG + Intergenic
1072574107 10:96684530-96684552 GGCAGCCTGGACCATGCTGCAGG + Intronic
1074185112 10:111094392-111094414 GGCAGAGAGAACCATGGTGATGG + Intergenic
1074460285 10:113630432-113630454 GGTGGCAATGACCATGGTGATGG + Intronic
1074914408 10:117941610-117941632 TGCAGCCAGGACCCTTGTGATGG + Intergenic
1075702653 10:124479192-124479214 GGCAGCCAGGACCCTGCAGAAGG + Intronic
1075709381 10:124522502-124522524 GACAGCTAGGACCTTGGCCAAGG + Intronic
1080842366 11:35996722-35996744 AGGAGCAAGGACCATGATGAAGG + Intronic
1081667026 11:44922628-44922650 AGCAGGTAAGACCAGGGTGATGG + Intronic
1083791625 11:64989640-64989662 GGCTGCTGGGACCAGGCTGAGGG - Exonic
1083994065 11:66263632-66263654 AGCAGGTAGGAGCATGGTCAGGG - Intronic
1088981762 11:114870807-114870829 AGCTGCTGGGGCCATGGTGAAGG - Intergenic
1089311903 11:117563776-117563798 GACAGCGAGGACCATTCTGAGGG + Intronic
1089632792 11:119794052-119794074 GGCAGCTACTCCCATGGTGATGG + Intergenic
1089813551 11:121152122-121152144 GGCAGGTAGGGTCCTGGTGAAGG - Intronic
1090404319 11:126467873-126467895 GGCAGATAGGTGCAGGGTGATGG + Intronic
1090744094 11:129693049-129693071 GACTGCTGGGAGCATGGTGAGGG - Intergenic
1094437892 12:30441652-30441674 TGCTGCTTGGACCATGGAGATGG - Intergenic
1095861430 12:46922338-46922360 TGCAGCTTGGACCTTGGTCATGG - Intergenic
1097267102 12:57752332-57752354 GGCAGCTGGTCACATGGTGAGGG - Exonic
1098484122 12:71000919-71000941 GGCAGGCAGTACCAGGGTGAGGG + Intergenic
1099374892 12:81887014-81887036 GGCAGCTTGGAGAATGGTGGTGG + Intergenic
1100555424 12:95688440-95688462 GGCAGATAGATCCATGCTGAGGG + Intronic
1100786899 12:98088340-98088362 GGCAGCTAGAATCATAGTTATGG - Intergenic
1100882083 12:99030287-99030309 TGCTGTTATGACCATGGTGATGG + Intronic
1102050547 12:109858595-109858617 TGCAGCTGGGACCATGATGCTGG + Intronic
1104070888 12:125344489-125344511 GGAAACTGGGACCATGGTGGGGG + Intronic
1104898616 12:132176131-132176153 TGCAGCCAGGGCCAAGGTGAGGG - Intergenic
1108324871 13:49320131-49320153 GGCAGCCAGGACACTGGTCAAGG + Intronic
1108576828 13:51798048-51798070 AGCAGCAAGGGCGATGGTGAGGG + Intronic
1110155377 13:72310489-72310511 GGCAGGTTGGCCCAGGGTGAGGG - Intergenic
1111805850 13:93039818-93039840 GGCAACAAAGACCCTGGTGAAGG + Intergenic
1112205801 13:97322236-97322258 GGCAGCTTGCACCATGGCGTGGG - Intronic
1116748842 14:48855822-48855844 GTCAGTTAGGACAATGGTGGGGG - Intergenic
1117116496 14:52518578-52518600 GGTGGCTTGGACCAGGGTGATGG - Intronic
1119413972 14:74457245-74457267 GGGAGCAAGGACCAGTGTGAGGG - Intergenic
1119569791 14:75660597-75660619 GGGAGCTAGGAAGATGGAGAAGG - Intronic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1122499674 14:102188417-102188439 GGCAGGCAGGGCTATGGTGAAGG + Intronic
1122770486 14:104095574-104095596 GGCAGCAAAGGCCATGGTGTCGG - Exonic
1122829156 14:104387308-104387330 GGCAGCCAGGAACCTGGCGATGG + Intergenic
1123762229 15:23441919-23441941 TCCAGCTAGGACCATGGTCTAGG - Intronic
1125021743 15:34992980-34993002 GGCAGCTGGGAGCAGGGAGAGGG + Intergenic
1126532351 15:49725067-49725089 AGCAGCTTAGATCATGGTGAGGG - Intergenic
1128594424 15:68930802-68930824 GGCATGTAGGACCAGGGAGAAGG - Intronic
1129467059 15:75730204-75730226 GGCAGCTGGGGCCAGGCTGAAGG - Intergenic
1131106761 15:89740163-89740185 GGTAGTTATGACCATGATGATGG + Intronic
1131982734 15:98011022-98011044 GGCAGCCAGGGCTATGGAGAAGG - Intergenic
1132180756 15:99751044-99751066 GCCAGCCATGACCATTGTGATGG + Intergenic
1134215959 16:12317133-12317155 GGCACCCAGGACCTTGGAGAAGG + Intronic
1134251439 16:12577031-12577053 GGCAGCTTTGACCATGGTGGTGG - Intergenic
1134490778 16:14694024-14694046 GGCAACTAGGAACTTGGAGAGGG + Intronic
1134496159 16:14733142-14733164 GGCAACTAGGAACTTGGAGAGGG + Intronic
1136107421 16:28040122-28040144 GGCAGCTAGGGCCATGGTGATGG - Intronic
1136264536 16:29107246-29107268 GGCAACTAGGAACTTGGAGAAGG + Intergenic
1136570229 16:31092462-31092484 GTCAGCCAGGACCATGGTGCTGG + Intronic
1137610399 16:49813797-49813819 AGCAGCTGAGACCATGGAGATGG + Intronic
1138130895 16:54479025-54479047 GGCAGTGATGGCCATGGTGATGG - Intergenic
1139492715 16:67295085-67295107 GGCAGCTAGGATGAGGGTGTGGG + Intronic
1141367884 16:83460873-83460895 AGCAGCTAGGACCATAGGCATGG - Intronic
1142111225 16:88332724-88332746 GGCTGCTGGGAACAGGGTGAGGG + Intergenic
1143329161 17:6121174-6121196 AGCAGCAAGGACCATTGGGATGG + Exonic
1143516669 17:7422706-7422728 AGGAGCTAGGGCCATGGAGATGG - Intergenic
1144771246 17:17760776-17760798 GGCAGCTAGGACCAAGCAGGAGG - Intronic
1146804597 17:35855305-35855327 GGCACCTAAGACCAATGTGAAGG - Exonic
1154229168 18:12538935-12538957 GGTAGCTGTGACCATGATGATGG - Intronic
1158499009 18:57983299-57983321 CTCAGCCAGGTCCATGGTGAAGG + Intergenic
1160989884 19:1856154-1856176 CACAGCAGGGACCATGGTGAGGG + Intronic
1163739422 19:19001885-19001907 GGCAGCTTGGGCCATAATGAAGG + Intronic
1164388693 19:27798070-27798092 GGAAGCTAGGAACATGGACAAGG + Intergenic
1165721227 19:38081460-38081482 GGCAGCCAGGCCCAGGATGAAGG - Exonic
1165920721 19:39296427-39296449 TGCAGCTTGGACCGTGGTGCTGG + Exonic
1166253050 19:41584665-41584687 GGAAACTAGGACCATGCTCAGGG - Intronic
1167144735 19:47675006-47675028 GGCAGCCTGGGCCATGGTGCAGG + Intronic
1168189449 19:54727130-54727152 GGAAGCTGGGGCCATGGAGAAGG + Intronic
1168191480 19:54741489-54741511 GGAAGCTGGCACCATGGAGAAGG + Intronic
1168193750 19:54758117-54758139 GGAAGCTGGCACCATGGAGAAGG + Intronic
1168197701 19:54787707-54787729 GGAAGCTGGCACCATGGAGAAGG + Intronic
1168206381 19:54853263-54853285 GGAAGCTGGGGCCATGGAGAAGG + Intronic
1168281624 19:55308916-55308938 CTCAGCTACGACAATGGTGAAGG - Intronic
925075907 2:1015193-1015215 GGCAGCTGGGACCATGTTGGTGG + Intronic
925404447 2:3596901-3596923 GGCAGGTAGGCACAGGGTGAGGG - Intronic
927318233 2:21710915-21710937 AGTAGCTTGGACTATGGTGATGG - Intergenic
928088902 2:28362136-28362158 GGCAGCCGGGACTATGGAGACGG - Intergenic
930246798 2:48991686-48991708 GGCTGCCAGAACAATGGTGAGGG + Intronic
932035655 2:68244283-68244305 GGTAGCTAGGACCTAGGAGAAGG - Intronic
932337497 2:70939274-70939296 GTCAGCTAAGACAATGGAGAGGG + Intronic
933705746 2:85288816-85288838 GGCATGTGGGGCCATGGTGAGGG - Intronic
933943716 2:87266525-87266547 AGAGGCTGGGACCATGGTGATGG + Intergenic
934620266 2:95799269-95799291 GGCAGCCAGGGCCATCATGAGGG + Intergenic
936336504 2:111595054-111595076 AGAGGCTGGGACCATGGTGATGG - Intergenic
936340852 2:111631321-111631343 GACTGCCTGGACCATGGTGATGG + Intergenic
937973975 2:127569965-127569987 GCCAGGTAGGACCATGGGGAGGG + Intronic
941858364 2:170253196-170253218 GGCAGCTTGGACCAAGGTGAAGG + Intronic
948489830 2:238305436-238305458 TGCAGCTAGGACCATGGGAGTGG - Intergenic
948512300 2:238476704-238476726 GGCAGCTTGGACTGTGGTGGTGG + Intergenic
1169310397 20:4533509-4533531 GGCAGCTGGGGACATGGTGTAGG - Intergenic
1172181642 20:33007468-33007490 GGCAGCTATGGCCTTAGTGAGGG - Intergenic
1173195086 20:40907687-40907709 GGCAGCTTGGACTGTGGTGGAGG - Intergenic
1174461281 20:50684686-50684708 GGCCGCTGGGACCAGGGTGGAGG + Intronic
1174668987 20:52288364-52288386 GGCAGCCTGGACCAAGGTGGTGG + Intergenic
1176287584 21:5026626-5026648 GGCAGGTAGGACCATCGAGGCGG + Exonic
1177892946 21:26828026-26828048 GGCAGCTGGGACTAGGGTGATGG + Intergenic
1178661699 21:34511974-34511996 GGCAGAAAGGCCCATGGTGATGG - Intergenic
1178894047 21:36544154-36544176 GGCAGGCAGCACCATGGTAATGG - Intronic
1179869597 21:44236849-44236871 GGCAGGTAGGACCATCGAGGCGG - Exonic
1181964623 22:26647789-26647811 GGGGGCCAGGACCATGGTGGTGG + Intergenic
1183564819 22:38606535-38606557 GGCAGAAAGGAGCATGGGGAAGG - Intronic
1185095414 22:48803639-48803661 GGCAGCTGGGAAGATGGTGGAGG + Intronic
1185212051 22:49575856-49575878 GGCAGCAAGGACTGTGCTGAGGG + Intronic
949484330 3:4523126-4523148 TGCAGCTGGGACCAAGGGGAGGG + Intronic
952897617 3:38088652-38088674 GGCAGCTTGGACATTGGTGGAGG - Intronic
953748337 3:45591847-45591869 GACAGCTGGGACCCTGGTGCAGG - Intronic
954705698 3:52479413-52479435 GGCAGCTGGGACTAGGGTAAGGG - Intronic
956146695 3:66198064-66198086 GTCAGCCAGCATCATGGTGAAGG + Intronic
956656779 3:71559902-71559924 GCCAGCTAGAACTATGGGGAAGG + Intronic
957464736 3:80572832-80572854 AGAAGCTAGGACAATGGTGAGGG - Intergenic
959944244 3:112110831-112110853 GGTAGGTAGCACCATGGTGTGGG + Intronic
960005920 3:112781089-112781111 GGGAGCTGGGACCATGGAAAAGG - Intronic
960969995 3:123132565-123132587 GTCTGCTAGGGCCTTGGTGAGGG + Intronic
965371236 3:167864364-167864386 GGCAGTAATGACCATGGTGCAGG - Intergenic
965387677 3:168064086-168064108 GCCTCCTGGGACCATGGTGAAGG - Intronic
967259066 3:187624046-187624068 GGCAACAAGGAGCATGGTGAGGG - Intergenic
978086942 4:104666395-104666417 GGCAGCTGTGACCGTGGGGAGGG - Intergenic
979994665 4:127416105-127416127 AGCAGCAAGGGCCATGGTGATGG - Intergenic
982114808 4:152089522-152089544 GGCAGCTTGGAGCAAGGTGGTGG + Intergenic
982771389 4:159400459-159400481 GGCTGCCAGGACCATGCTGAAGG - Intergenic
987200432 5:15571768-15571790 GGGAGCAAGCACCATGGAGAAGG - Intronic
987801976 5:22709940-22709962 GGCAAGTAGGAACATGGTGTAGG + Intronic
994301418 5:98152636-98152658 GGGAGCTGGGACTATGGAGAAGG + Intergenic
995264191 5:110139010-110139032 GGCAGCTAGAAGCACAGTGATGG + Intergenic
997436010 5:133876321-133876343 GCCAGAGAGGACCAAGGTGAAGG + Intergenic
998128590 5:139639874-139639896 GGCAGTTGGGACCATGATGGGGG - Intergenic
1001443095 5:171761149-171761171 GGGAGCTAGGACCAGGATCAAGG - Intergenic
1001493906 5:172174653-172174675 GGCAGCTGCCACCATGGTCAGGG + Intronic
1001878316 5:175220137-175220159 GGCATCTAGGGCCATGGCGATGG - Intergenic
1001932497 5:175683292-175683314 GACCGCAAGGACCACGGTGATGG - Exonic
1006626941 6:35404381-35404403 GGAAGCTAGTACTATTGTGATGG + Intronic
1006882669 6:37353832-37353854 GGCGGCTAGGACTGGGGTGATGG + Intergenic
1007173728 6:39882510-39882532 TGCAGCTAGGACCAACGTGGAGG - Intronic
1010450329 6:75995182-75995204 GATAGCTAGGACATTGGTGATGG - Intronic
1013409490 6:109871461-109871483 TGCAGATAGGATCATGCTGATGG + Intergenic
1014043888 6:116861635-116861657 GGAAGCTGGGCCCATGGAGAGGG + Intergenic
1016721747 6:147306340-147306362 GGTAGCTAGGAACATGGAGGGGG + Intronic
1017783342 6:157733630-157733652 GGCAGCTAGGACCATGGTGAGGG + Intronic
1019049259 6:169170489-169170511 GGCAGCCAGGGCCCTGGTGGAGG - Intergenic
1019653458 7:2173325-2173347 GGCAGCTAGAGCTGTGGTGATGG - Intronic
1020265745 7:6558970-6558992 GGCATCTTGGACCAGGGTGGTGG - Intergenic
1022970608 7:35513616-35513638 GGCAGCAAGGGCCATGCTGATGG - Intergenic
1028689495 7:93635733-93635755 GGCAGCTTGGACTATGGCTATGG + Intronic
1029532331 7:101133758-101133780 GGCAGCAATGAACATGCTGAGGG - Exonic
1029924925 7:104305215-104305237 GACTGCTAGGACAAAGGTGAAGG - Intergenic
1030259167 7:107544212-107544234 GGCACCTGGGACCATGGGGGTGG - Intronic
1030259184 7:107544271-107544293 GGCACCTGGGACCTTGGGGATGG - Intronic
1032467179 7:132153459-132153481 GGCAGCGAGGACCTAAGTGAAGG + Intronic
1032776086 7:135114672-135114694 GGTAGCTTGGACCAGGGTGGTGG - Intronic
1034268357 7:149791771-149791793 GGCAGTGAGGACCATGGGGGAGG - Intergenic
1039840041 8:41286542-41286564 GGCAGCAAGGAGCATGGACATGG - Intronic
1041169886 8:55130639-55130661 GGCATCTAGGAACACTGTGAAGG - Intronic
1041327252 8:56681637-56681659 GGCTTCTAGGACCATGCAGATGG - Intergenic
1043943351 8:86221871-86221893 GTCAGCTAGCACCATTGTTACGG - Intronic
1046016610 8:108613116-108613138 GGCAGCTAGGATCAAAGTAAGGG - Intronic
1049856368 8:144864495-144864517 TTCAGCTAGGTCCTTGGTGACGG + Intergenic
1051894826 9:21975703-21975725 GGCAGATAGGAAAATGGGGAGGG + Intronic
1052244796 9:26321457-26321479 GGCAGGAAGGACCTGGGTGATGG - Intergenic
1052996066 9:34552193-34552215 GGCAGCCAGGGCCAGAGTGATGG + Exonic
1054953642 9:70883180-70883202 TTCAGCTATGACCATGGGGATGG - Intronic
1056214154 9:84392615-84392637 GGTAGCTTGGACCGTGGTGGTGG + Intergenic
1057829452 9:98395646-98395668 TGCAGCCAGCTCCATGGTGAAGG - Intronic
1057961857 9:99464809-99464831 GGCAGCCAAGACCATGCTCAGGG + Intergenic
1061268194 9:129520686-129520708 GGGAGGCAGGACCATGGTCAGGG - Intergenic
1061862251 9:133474005-133474027 GCCTGCGAGGTCCATGGTGAGGG + Exonic
1186908907 X:14140562-14140584 GGCACCTAGGACAATGTCGATGG + Intergenic
1187684339 X:21801224-21801246 TTCAGTTAGGCCCATGGTGAAGG - Intergenic
1194267842 X:91777750-91777772 GGCAGCTAAGAAGATGGAGAAGG + Intergenic
1195513320 X:105742905-105742927 AGCAACTAGAACAATGGTGATGG - Intronic
1198777666 X:140197920-140197942 GACAGCTAGGAGCAAGATGAAGG - Intergenic
1200585051 Y:4998675-4998697 GGCAGCTAAGAAGATGGAGAAGG + Intergenic
1200705142 Y:6436232-6436254 GGCAGTGAGGCCCAGGGTGAAGG - Intergenic
1200918562 Y:8592882-8592904 GGCAGCGAGGCCCAGGATGAAGG + Intergenic
1201028969 Y:9728476-9728498 GGCAGTGAGGCCCAGGGTGAAGG + Intergenic