ID: 1017784300

View in Genome Browser
Species Human (GRCh38)
Location 6:157742088-157742110
Sequence GTTAGCAGTGCTATTACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017784300 Original CRISPR GTTAGCAGTGCTATTACTGC TGG (reversed) Intronic
900521041 1:3105693-3105715 GTTAGGAATGTAATTACTGCGGG - Intronic
900805893 1:4768204-4768226 GTGAGCAGTACTAGTGCTGCAGG + Intronic
901604462 1:10448478-10448500 GTGAGATGTGCTGTTACTGCAGG - Intronic
909860251 1:80595659-80595681 TTTAGCAGTTCTTTTAGTGCTGG - Intergenic
911265712 1:95741269-95741291 TTTAGCAGTTCTTTTAGTGCTGG + Intergenic
912542351 1:110426571-110426593 GTTGGCATTGCTAATACTGGGGG - Intergenic
913067714 1:115271839-115271861 GTTGGCAGAGCTATTTCTGGTGG - Intergenic
919961165 1:202470524-202470546 GTTAGCAGTGATACTGCTGATGG - Intronic
923469919 1:234281310-234281332 GTTGGCAGTGCTGTTTCTTCTGG - Intronic
1066487894 10:35865551-35865573 TTTAGCATTGCTAGTTCTGCTGG - Intergenic
1069511156 10:69043403-69043425 GTCAGCACTGCTTTTCCTGCTGG + Intergenic
1073701080 10:105927232-105927254 TTTAGCAGTTCTTTTAGTGCTGG - Intergenic
1080228413 11:29987104-29987126 GTCAGCAGGGCTATTCCTTCTGG - Intergenic
1081229513 11:40567685-40567707 CTTAGCAGTGATAATAATGCTGG + Intronic
1083035210 11:59630594-59630616 GTTAGCAGTGTTTTTTCTGGGGG + Intergenic
1084998946 11:73011427-73011449 GTTAGCAGTGTAAGTGCTGCTGG - Intronic
1086844593 11:91732547-91732569 TTTAGCAGTTCTTATACTGCTGG - Intergenic
1099392246 12:82096303-82096325 GTTAGCAGTTCTTGTAGTGCTGG + Intergenic
1104997570 12:132668194-132668216 GTAAGCTGTGCTCTCACTGCAGG - Intronic
1106706658 13:32287741-32287763 GTGAGCAATGCTAATACTGCTGG + Intronic
1109201173 13:59433363-59433385 TTTAGCAGTTCTAGTAGTGCTGG + Intergenic
1111026485 13:82533948-82533970 TTTAGCAGTTCTTATACTGCAGG - Intergenic
1114397642 14:22381300-22381322 ATTAGCTGTGATCTTACTGCTGG + Intergenic
1115799427 14:36975924-36975946 GTAAGCAGTGCTACTGTTGCGGG + Intronic
1120777146 14:88450468-88450490 TTTAGCAGTTCTTTTAGTGCTGG + Intronic
1121575617 14:94983162-94983184 TTTAGCAGTTCTTGTACTGCTGG - Intergenic
1126521219 15:49596430-49596452 TTTAGCAGTTCTTTTAGTGCTGG - Intronic
1126796837 15:52266461-52266483 GTTAGCAGTGAGATTACCCCTGG - Intronic
1127066283 15:55243006-55243028 TTTATCACTGCTATAACTGCTGG - Intronic
1128288069 15:66455035-66455057 TCTAACAGTGCTATTGCTGCTGG + Intronic
1138787167 16:59861062-59861084 GTTACAAGTGCTATTCCTGAAGG - Intergenic
1140993051 16:80232842-80232864 GTTTGCAGTCCTATTGCAGCAGG + Intergenic
1143125012 17:4636428-4636450 TTTATCGGTGCTATTTCTGCAGG + Intronic
1157179752 18:45486420-45486442 GGTAGCAGTGTTCTGACTGCTGG - Intronic
1157401171 18:47389783-47389805 GTTACCAGTGCTATTATTCTGGG + Intergenic
1160430333 18:78806731-78806753 CTTAGCAGTGTTAGTACTGGAGG - Intergenic
1167766876 19:51489328-51489350 GGTAGCTGTGATATTACTGGGGG - Intronic
925387083 2:3469577-3469599 GCTGGCAGTGCTATTCTTGCTGG - Intronic
930600303 2:53435107-53435129 GTTAGCAGTCCTGCTACTCCTGG - Intergenic
931693764 2:64857249-64857271 GTTATCAGGGCTATCACTGGTGG + Intergenic
936760818 2:115779447-115779469 GGTAGCAGTCCTACTCCTGCAGG - Intronic
938579546 2:132633921-132633943 GGTAGCAGTGTTATTAGTGTTGG + Intronic
939782567 2:146466132-146466154 GTTAGCATTTTTATCACTGCTGG + Intergenic
945904449 2:215575431-215575453 GTTAGCAGTGGTAGCACTGAAGG - Intergenic
947681606 2:232038668-232038690 GTTAGAAGTGCTCTTGCTTCAGG + Intronic
1175176048 20:57112728-57112750 TTTAGCAGTGCTAGTGCAGCCGG - Intergenic
957906354 3:86561232-86561254 GTCAGCAGAGCTATGAGTGCAGG + Intergenic
959410652 3:106017024-106017046 GTCACCACTACTATTACTGCTGG - Intergenic
960590435 3:119360515-119360537 CTTAGCAGTGTTATGACTTCTGG + Intronic
962209073 3:133461373-133461395 GGTAGGAGTGCAATTACTTCTGG - Intronic
977635696 4:99295278-99295300 TTTAGCAGTTCTTTTAGTGCTGG - Intergenic
977842411 4:101724659-101724681 ATTCACAGTTCTATTACTGCTGG + Intronic
981127152 4:141119862-141119884 CTTAGCAGAGCTATTCTTGCTGG - Intronic
981495045 4:145381450-145381472 GTTACCACTGCTACTACTACAGG - Intergenic
985221713 4:187713330-187713352 TTTAGTAGTGCTCTTTCTGCAGG + Intergenic
987360318 5:17100445-17100467 GTCAGCAGTGCTACTCCTGGTGG + Intronic
988339280 5:29949204-29949226 GTTAGAACTGCTATTCCTGGTGG - Intergenic
991425838 5:66490852-66490874 GTTAGCAGTATTTTCACTGCAGG + Intergenic
992075822 5:73191823-73191845 GGTGGCAGTGGTATTATTGCAGG + Intergenic
993249847 5:85506550-85506572 GTTAACATTGCCATTAGTGCAGG - Intergenic
993857390 5:93093334-93093356 GTTAACAGTGAGATTAATGCAGG - Intergenic
993886874 5:93425264-93425286 TTTAGCAGTTCGATGACTGCTGG + Intergenic
994115702 5:96059414-96059436 ATTTGCCGTGCTATTATTGCAGG - Intergenic
998781396 5:145660543-145660565 GAAAGCACTGCTGTTACTGCTGG - Intronic
1002775594 6:325224-325246 GTGTGCAGTGCTATATCTGCTGG + Intronic
1004073498 6:12324145-12324167 GCTAGCTGGGCTATTACTGCAGG - Intergenic
1005276864 6:24228998-24229020 CTTAGCAGTGCTATGATTTCTGG - Intronic
1010996755 6:82542455-82542477 GATATGAGTGCTATTACTTCAGG - Intergenic
1011620245 6:89235899-89235921 TTTAGCAGTTCTTTTAGTGCTGG + Intergenic
1012261548 6:97093143-97093165 GTTAGCAGCAATATTACTGCAGG - Intronic
1014824356 6:126031865-126031887 GTTAGCTGTGATACTACTGAGGG + Intronic
1017784300 6:157742088-157742110 GTTAGCAGTGCTATTACTGCTGG - Intronic
1018335976 6:162790219-162790241 ATTGGCAGTTCTGTTACTGCAGG + Intronic
1019122920 6:169819062-169819084 TTTAGCAGTGCTTGTAGTGCTGG + Intergenic
1026583585 7:71637789-71637811 GTGAGCAGTGCTAATATTGCTGG + Intronic
1027691538 7:81353038-81353060 TTTAGCAGTGCTTATAGTGCTGG + Intergenic
1031465285 7:122102448-122102470 GTTAGCATTGCTGTTTCTGGTGG + Intronic
1033821479 7:145139553-145139575 GATAGCATTGTTATTATTGCAGG + Intergenic
1039927275 8:41946669-41946691 GTTGGCAGTGCTTTTCCTGGTGG + Exonic
1042768257 8:72351165-72351187 CTTAGCAGTGCTCATAGTGCTGG + Intergenic
1044267456 8:90200026-90200048 GGCAGCAGTGCCCTTACTGCAGG + Intergenic
1048343285 8:133556886-133556908 GGCAGCGGTGCTATTAATGCAGG + Intronic
1048599026 8:135899164-135899186 GATAGCATTGCTATTCTTGCAGG + Intergenic
1056396822 9:86188854-86188876 GTTAGCAGTTCTTGTAGTGCTGG - Intergenic
1058411105 9:104732562-104732584 GTTTCCATTGCTATTCCTGCGGG + Intergenic
1203450531 Un_GL000219v1:110308-110330 ATTATCATTGCTATAACTGCTGG + Intergenic
1186647196 X:11519665-11519687 GTAAGCAGTGTTATTTCTGAGGG - Intronic
1188059663 X:25585443-25585465 GTTAGCAGGGCTGTTTCTTCTGG - Intergenic
1191045495 X:56131462-56131484 TTTAGCAGTTCTTGTACTGCTGG - Intergenic
1195237299 X:102913149-102913171 TTTAGCAGTTCTTGTACTGCTGG - Intergenic
1197055328 X:122112200-122112222 TTTAGCAGTGCTTGTAGTGCTGG + Intergenic
1197463578 X:126773154-126773176 TTTAGCAGTTCTTTTAGTGCTGG - Intergenic
1197845152 X:130793573-130793595 GCTAGCAGTGATACTACAGCTGG + Intronic
1199121747 X:144062429-144062451 TTTAGCAGTTCTTGTACTGCTGG - Intergenic
1199880301 X:151969159-151969181 GTAAGCAGTGCTGGGACTGCAGG + Intronic
1202296358 Y:23361803-23361825 GTTAGCAGTGATATTGCTGATGG - Intergenic
1202574449 Y:26308793-26308815 GTTAGCAGTGATATTGCTGATGG + Intergenic