ID: 1017786146

View in Genome Browser
Species Human (GRCh38)
Location 6:157758697-157758719
Sequence CCCTCATGGGGCTTATCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786146_1017786156 7 Left 1017786146 6:157758697-157758719 CCCCTGGATAAGCCCCATGAGGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786146 Original CRISPR CCCTCATGGGGCTTATCCAG GGG (reversed) Intronic