ID: 1017786148

View in Genome Browser
Species Human (GRCh38)
Location 6:157758698-157758720
Sequence ACCCTCATGGGGCTTATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786148_1017786157 30 Left 1017786148 6:157758698-157758720 CCCTGGATAAGCCCCATGAGGGT No data
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786148_1017786156 6 Left 1017786148 6:157758698-157758720 CCCTGGATAAGCCCCATGAGGGT No data
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786148 Original CRISPR ACCCTCATGGGGCTTATCCA GGG (reversed) Intronic