ID: 1017786149

View in Genome Browser
Species Human (GRCh38)
Location 6:157758699-157758721
Sequence CACCCTCATGGGGCTTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786149_1017786157 29 Left 1017786149 6:157758699-157758721 CCTGGATAAGCCCCATGAGGGTG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786149_1017786156 5 Left 1017786149 6:157758699-157758721 CCTGGATAAGCCCCATGAGGGTG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786149 Original CRISPR CACCCTCATGGGGCTTATCC AGG (reversed) Intronic