ID: 1017786153

View in Genome Browser
Species Human (GRCh38)
Location 6:157758709-157758731
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786153_1017786157 19 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786153_1017786156 -5 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786153_1017786158 25 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786158 6:157758757-157758779 GTGTAGTGACTAGCAGGTAATGG 0: 1
1: 0
2: 0
3: 3
4: 71
1017786153_1017786159 26 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786159 6:157758758-157758780 TGTAGTGACTAGCAGGTAATGGG 0: 1
1: 0
2: 1
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786153 Original CRISPR GCCACAGTCCCACCCTCATG GGG (reversed) Intronic