ID: 1017786156

View in Genome Browser
Species Human (GRCh38)
Location 6:157758727-157758749
Sequence GTGGCTGAGTCACAGCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 192}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786144_1017786156 13 Left 1017786144 6:157758691-157758713 CCATGTCCCCTGGATAAGCCCCA No data
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786154_1017786156 -6 Left 1017786154 6:157758710-157758732 CCCATGAGGGTGGGACTGTGGCT 0: 1
1: 0
2: 2
3: 27
4: 232
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786148_1017786156 6 Left 1017786148 6:157758698-157758720 CCCTGGATAAGCCCCATGAGGGT No data
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786153_1017786156 -5 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786149_1017786156 5 Left 1017786149 6:157758699-157758721 CCTGGATAAGCCCCATGAGGGTG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786146_1017786156 7 Left 1017786146 6:157758697-157758719 CCCCTGGATAAGCCCCATGAGGG 0: 1
1: 0
2: 0
3: 10
4: 87
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192
1017786155_1017786156 -7 Left 1017786155 6:157758711-157758733 CCATGAGGGTGGGACTGTGGCTG 0: 1
1: 0
2: 1
3: 61
4: 434
Right 1017786156 6:157758727-157758749 GTGGCTGAGTCACAGCTGTATGG 0: 1
1: 0
2: 2
3: 22
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786156 Original CRISPR GTGGCTGAGTCACAGCTGTA TGG Intronic