ID: 1017786157

View in Genome Browser
Species Human (GRCh38)
Location 6:157758751-157758773
Sequence CAGCACGTGTAGTGACTAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786149_1017786157 29 Left 1017786149 6:157758699-157758721 CCTGGATAAGCCCCATGAGGGTG 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786148_1017786157 30 Left 1017786148 6:157758698-157758720 CCCTGGATAAGCCCCATGAGGGT No data
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786153_1017786157 19 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786155_1017786157 17 Left 1017786155 6:157758711-157758733 CCATGAGGGTGGGACTGTGGCTG 0: 1
1: 0
2: 1
3: 61
4: 434
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data
1017786154_1017786157 18 Left 1017786154 6:157758710-157758732 CCCATGAGGGTGGGACTGTGGCT 0: 1
1: 0
2: 2
3: 27
4: 232
Right 1017786157 6:157758751-157758773 CAGCACGTGTAGTGACTAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786157 Original CRISPR CAGCACGTGTAGTGACTAGC AGG Intronic