ID: 1017786159

View in Genome Browser
Species Human (GRCh38)
Location 6:157758758-157758780
Sequence TGTAGTGACTAGCAGGTAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786155_1017786159 24 Left 1017786155 6:157758711-157758733 CCATGAGGGTGGGACTGTGGCTG 0: 1
1: 0
2: 1
3: 61
4: 434
Right 1017786159 6:157758758-157758780 TGTAGTGACTAGCAGGTAATGGG 0: 1
1: 0
2: 1
3: 10
4: 134
1017786153_1017786159 26 Left 1017786153 6:157758709-157758731 CCCCATGAGGGTGGGACTGTGGC 0: 1
1: 0
2: 3
3: 34
4: 209
Right 1017786159 6:157758758-157758780 TGTAGTGACTAGCAGGTAATGGG 0: 1
1: 0
2: 1
3: 10
4: 134
1017786154_1017786159 25 Left 1017786154 6:157758710-157758732 CCCATGAGGGTGGGACTGTGGCT 0: 1
1: 0
2: 2
3: 27
4: 232
Right 1017786159 6:157758758-157758780 TGTAGTGACTAGCAGGTAATGGG 0: 1
1: 0
2: 1
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786159 Original CRISPR TGTAGTGACTAGCAGGTAAT GGG Intronic