ID: 1017786701

View in Genome Browser
Species Human (GRCh38)
Location 6:157762679-157762701
Sequence GCATCCTCCCTAGCCACAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 238}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017786701_1017786708 -10 Left 1017786701 6:157762679-157762701 CCCGCTGTGGCTAGGGAGGATGC 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1017786708 6:157762692-157762714 GGGAGGATGCAGTGGGGGTTGGG No data
1017786701_1017786710 -8 Left 1017786701 6:157762679-157762701 CCCGCTGTGGCTAGGGAGGATGC 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1017786710 6:157762694-157762716 GAGGATGCAGTGGGGGTTGGGGG 0: 1
1: 0
2: 7
3: 103
4: 817
1017786701_1017786709 -9 Left 1017786701 6:157762679-157762701 CCCGCTGTGGCTAGGGAGGATGC 0: 1
1: 0
2: 0
3: 25
4: 238
Right 1017786709 6:157762693-157762715 GGAGGATGCAGTGGGGGTTGGGG 0: 1
1: 0
2: 2
3: 79
4: 826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017786701 Original CRISPR GCATCCTCCCTAGCCACAGC GGG (reversed) Intronic
900379471 1:2376705-2376727 GCATCCTCGGTACCCACCGCTGG + Intronic
900887188 1:5423403-5423425 GCAGCCTCCACAGGCACAGCAGG - Intergenic
901534768 1:9875078-9875100 GCTTCCTCCCCACCCCCAGCAGG + Intronic
901602177 1:10430765-10430787 GCTTCCTCCCCAGCCAGCGCAGG - Intronic
904057413 1:27680546-27680568 GCACCCTCTGAAGCCACAGCTGG + Intergenic
906243387 1:44256468-44256490 CCATCCTCCCTAACCCCAGATGG + Intronic
908265256 1:62372384-62372406 GCAGCCTCCCAAACCAGAGCAGG - Intergenic
909802804 1:79833882-79833904 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
914392618 1:147236074-147236096 GCTGCCTGCCTTGCCACAGCTGG - Intronic
914988096 1:152476749-152476771 GCACCCTCTGAAGCCACAGCCGG + Intergenic
915812449 1:158928818-158928840 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
916035035 1:160914193-160914215 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
916734438 1:167594956-167594978 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
917720732 1:177784288-177784310 GCCTCCTCCCTATCCCCAGCTGG - Intergenic
920184305 1:204151018-204151040 CCATCTTCCCCAGCCCCAGCTGG - Intronic
921440563 1:215181733-215181755 CCAGCCTCACTGGCCACAGCTGG - Intronic
922774888 1:228210109-228210131 CCAGCCTCCCCACCCACAGCAGG - Intronic
924469213 1:244325102-244325124 GCAGCCTCCCAGGCCAGAGCAGG + Intergenic
1063807426 10:9661613-9661635 TCATCCTCCCTGGCCCCTGCTGG + Intergenic
1067273327 10:44811594-44811616 GCATCCTGCCTCTCCACAGGAGG - Intergenic
1067914998 10:50387757-50387779 GCAGCCTCCCAAGCCACGGTAGG + Intronic
1068358275 10:55940911-55940933 GCAGCCTCCCAAGCCAGAGCTGG + Intergenic
1069621798 10:69841821-69841843 TCATCCTCCCTTCCCACTGCAGG - Intronic
1071512284 10:86269626-86269648 TCATCCTCCCTGGTCACAGCTGG + Intronic
1071908697 10:90205090-90205112 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1071939379 10:90572053-90572075 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1072601594 10:96936030-96936052 GCAGCCTCCCGAGCCACAGTAGG + Intronic
1073112736 10:101072226-101072248 GCCTCCTCCCAGGACACAGCCGG - Intergenic
1075430336 10:122374914-122374936 GCCTCCCCGCTCGCCACAGCGGG - Intronic
1075437497 10:122456254-122456276 GCATCCTCTCGAGCCAGAGTAGG - Intronic
1076099409 10:127763555-127763577 GCAACCTCCCGAGCCAAAGTAGG + Intergenic
1076907828 10:133372392-133372414 ACCTCCTCCCCAGCCACAGGGGG - Intronic
1077284387 11:1759274-1759296 GCCTCCCTCCCAGCCACAGCCGG + Intronic
1077523528 11:3050366-3050388 GCACACTCCCTAGCCAAAACTGG + Intronic
1080301438 11:30789489-30789511 GCAGCCTTCTGAGCCACAGCAGG - Intergenic
1080485588 11:32704038-32704060 GCAACCTCCCTTGCTGCAGCTGG - Intronic
1080652394 11:34233072-34233094 GCTACCTCCCTAGCCACTGGAGG - Intronic
1082626589 11:55494724-55494746 GGAGCCTCCTCAGCCACAGCTGG - Intergenic
1083301141 11:61740160-61740182 GCTTCCTCCCCTGACACAGCTGG + Intronic
1086150685 11:83607013-83607035 GCAGCCTCCTGAGACACAGCGGG + Intronic
1086843546 11:91719316-91719338 GTATCCTCTCCAGACACAGCTGG - Intergenic
1086991981 11:93313547-93313569 CCATCATAGCTAGCCACAGCTGG + Intergenic
1087204095 11:95375993-95376015 GCATCCAGCTAAGCCACAGCTGG - Intergenic
1091278737 11:134370131-134370153 CCTTCCTCCCTGGCCTCAGCAGG + Intronic
1092513523 12:9184147-9184169 GCACCCTGCCTTGCCACTGCTGG + Intronic
1093093027 12:14942432-14942454 CCCTCCTCCCTGTCCACAGCTGG - Exonic
1096027131 12:48376335-48376357 GCATCCTCCACAGTCATAGCTGG - Intergenic
1096661604 12:53128789-53128811 GCCTCCTCCTTAGACACACCTGG - Intergenic
1099936917 12:89137334-89137356 GCAGCCTCCCGAGCCAGAGTGGG - Intergenic
1100020621 12:90065168-90065190 GCATCTTCCCCAGCGACTGCTGG + Intergenic
1101101860 12:101401964-101401986 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1102469369 12:113150850-113150872 GCAGCCACCCTAGCCACACCAGG + Intronic
1103878462 12:124147653-124147675 GGATTCTCCCTAGACTCAGCTGG - Intronic
1103931582 12:124453548-124453570 GCCTCCTCCCTGGCCCCTGCTGG - Intronic
1105293674 13:19070818-19070840 GCAGCCTCCCCATCCACAGCTGG + Intergenic
1106872272 13:34034640-34034662 GCAGCCTCCTGAGCCACAGCAGG - Intergenic
1110982319 13:81916648-81916670 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1111044805 13:82800592-82800614 GCATCCTCCCGAGCCAGATGAGG + Intergenic
1111158217 13:84356546-84356568 GGATCCTCCCTATGCAAAGCAGG + Intergenic
1111202965 13:84962606-84962628 GGCACCTCCCTCGCCACAGCTGG + Intergenic
1111474443 13:88726245-88726267 GCTGCCTGCCTTGCCACAGCTGG + Intergenic
1111935463 13:94552507-94552529 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1114757875 14:25280748-25280770 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1117204857 14:53431375-53431397 GCAGCCTCCCGAGCCAGAGCAGG + Intergenic
1118075645 14:62295687-62295709 GCATCCTCCCTGTCCACAAATGG - Intergenic
1118868798 14:69724669-69724691 GCATGCTACCTAGACACAGAAGG + Intergenic
1120649407 14:87113537-87113559 GCAGCCTCCCGAGCCAGAGTAGG - Intergenic
1120732639 14:88020699-88020721 GCAGCCTCCTGAGCCACAGTAGG - Intergenic
1121955204 14:98207113-98207135 GCACCACCCCTAGCCTCAGCAGG - Intergenic
1122202647 14:100131900-100131922 GCAGCCTCCTCAGCTACAGCAGG - Intronic
1127872954 15:63088575-63088597 GCTTCCCCACTAGCCACAGGAGG - Intergenic
1132017452 15:98331379-98331401 ACATACTCCCTATCCACTGCAGG + Intergenic
1132659027 16:1053436-1053458 GCAGCCTCCTCAGCAACAGCTGG + Intergenic
1133434948 16:5771163-5771185 GGCTGCTCCCTAGACACAGCGGG + Intergenic
1134281269 16:12819126-12819148 TCAGCCTCCCTAGCAGCAGCTGG - Intergenic
1135132561 16:19864791-19864813 GCATGCTCCCTTGCCACAGGAGG - Intronic
1135193378 16:20373842-20373864 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1135304749 16:21358400-21358422 GCATCTGCGCAAGCCACAGCAGG + Intergenic
1136301490 16:29337527-29337549 GCATCTGCGCAAGCCACAGCAGG + Intergenic
1137300267 16:47143028-47143050 GCAGCCTCCGTGGCCGCAGCAGG + Intronic
1137660071 16:50197625-50197647 GCAGCCTCCCGAGCCAGAGTAGG + Intronic
1140230921 16:73116466-73116488 GCACCCTCCCCAGCCACTTCTGG - Intergenic
1140359288 16:74331018-74331040 GCGTGCTCCCCATCCACAGCTGG - Intergenic
1142063193 16:88044225-88044247 GCATCTGCGCAAGCCACAGCAGG + Intronic
1142524435 17:529545-529567 GCAGCCTCCTCAGCCAGAGCAGG + Intronic
1146556769 17:33831707-33831729 GCCTCCTCCCTACTGACAGCAGG + Intronic
1146905668 17:36616345-36616367 AAATCATCCCCAGCCACAGCTGG + Intergenic
1149451035 17:56750241-56750263 CCCTCCCCCCTAGGCACAGCTGG + Intergenic
1151213917 17:72564541-72564563 GACACCTCCCTCGCCACAGCTGG + Intergenic
1151928098 17:77213495-77213517 GCGGCCACCCTCGCCACAGCAGG + Intronic
1151996122 17:77610258-77610280 GCAGCCTCCCGAGCCAGAGTGGG + Intergenic
1153169314 18:2297061-2297083 GCAGCCTCCTGAGCCACAGTGGG - Intergenic
1153535808 18:6100688-6100710 ACATCCTCCCTAGGCACCCCTGG + Intronic
1153750236 18:8222040-8222062 GCAGCCTCCCAAGCCAAAGTAGG - Intronic
1155215880 18:23642456-23642478 GCTGCCTGCCTCGCCACAGCTGG + Intronic
1155362314 18:25015786-25015808 GCTTCCTCCCCAGCCTCAGTGGG + Intergenic
1156065642 18:33140023-33140045 GCACCCTCTGAAGCCACAGCCGG - Intronic
1157149007 18:45195934-45195956 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1157179101 18:45479862-45479884 CCTTCCTCCCTGGCCACATCCGG - Intronic
1157790196 18:50524529-50524551 TCAACCTCACAAGCCACAGCTGG - Intergenic
1161314412 19:3611216-3611238 GCATCCTCCATACCCGCTGCGGG + Exonic
1161392645 19:4029175-4029197 GAGACCTCCCCAGCCACAGCCGG - Intronic
1161714198 19:5866338-5866360 GCACCATCCCCAGCCCCAGCTGG + Exonic
1162087170 19:8255803-8255825 GCTCCCTCCCCATCCACAGCTGG + Exonic
1163169174 19:15518901-15518923 CCATCATCCCAACCCACAGCAGG - Intronic
1164108634 19:22133879-22133901 GCATGCTTCCTATCCACAGGTGG + Intergenic
1164181232 19:22820510-22820532 GCTTCCTTCCTATCCACAGGTGG + Intergenic
1165311839 19:35033239-35033261 TCATCCTCCCAAGCCCCATCTGG - Intronic
1166239113 19:41477726-41477748 TCATCCTCCATGGCCAGAGCTGG - Intergenic
1167386296 19:49166081-49166103 GCATCCTCCATGGCCACTGCGGG - Exonic
1167555077 19:50189399-50189421 ACCATCTCCCTAGCCACAGCAGG - Intronic
925046143 2:774112-774134 CCATCCTGCCTCCCCACAGCAGG + Intergenic
926564259 2:14452594-14452616 GGACCCTCTGTAGCCACAGCTGG + Intergenic
927548760 2:23978308-23978330 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
927695148 2:25234836-25234858 GCATCCTCCCCATCAAGAGCAGG + Intronic
929098614 2:38287280-38287302 GCTCCCTCCCTAGCTACTGCCGG - Intergenic
931393839 2:61868268-61868290 GCAGCCTCCCAAGCCAAAGTAGG + Exonic
932435906 2:71702462-71702484 GCTGCCTCCCCAGCCACAGGGGG + Intergenic
934925679 2:98380389-98380411 GCTTCCTGCCTGGCCCCAGCAGG - Intronic
935205072 2:100890238-100890260 GCCTGCTCCCTGGACACAGCCGG - Intronic
935722462 2:105991532-105991554 GAATTCTCCCCTGCCACAGCAGG + Intergenic
936075328 2:109398080-109398102 GCAGACTCCCCTGCCACAGCCGG + Intronic
936147885 2:109993740-109993762 GCATCTTTCCTCCCCACAGCTGG - Intergenic
936196806 2:110377707-110377729 GCATCTTTCCTCCCCACAGCTGG + Intergenic
936290293 2:111217527-111217549 GCACCCACCCAAACCACAGCTGG - Intergenic
937770760 2:125718327-125718349 GCAATCTCCCAAGCCAGAGCAGG - Intergenic
937856857 2:126678559-126678581 TCCTCCTCCCTAGCCAGAGAGGG - Intronic
938450982 2:131419761-131419783 GCAGCCTCCCTTCCCACTGCTGG + Intergenic
938795514 2:134715836-134715858 GGATCCTCCCTACCCATAGCTGG + Intronic
939951691 2:148483124-148483146 TCATCCTCCATAGCCATAGCGGG + Exonic
939998059 2:148938656-148938678 TCACCCTCCCCAGCCACAGTGGG - Intronic
942462000 2:176175111-176175133 GCCTCCTCCCCCGCCACCGCCGG + Intergenic
943027993 2:182652539-182652561 CTATCCTCCCCAGCCACAGCCGG + Intergenic
944527188 2:200631217-200631239 GTAGCCTCTCTAGCCTCAGCTGG - Intronic
946410314 2:219512239-219512261 GCATCCTGCCTACCCTCAGGAGG + Intergenic
946419937 2:219559071-219559093 GAATCCTGCTTAGCCACATCAGG - Intronic
946546718 2:220752038-220752060 TCATCCACCTCAGCCACAGCAGG + Intergenic
947131728 2:226933680-226933702 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
947348366 2:229217519-229217541 GCATCCTCCCTGTCTACAGGTGG - Intronic
947674078 2:231961711-231961733 GCATTCTCCTTAGCAACTGCGGG + Exonic
947958783 2:234217351-234217373 GCAGCCTCCTTAGTCCCAGCAGG - Intergenic
948784513 2:240345342-240345364 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
949057509 2:241936596-241936618 GCCTCCTCCCCAGGCTCAGCGGG + Intergenic
1169023746 20:2349859-2349881 GCACCCTCCCCAGCCAGGGCAGG + Intergenic
1169438596 20:5615097-5615119 GCAGCCTCCTTAGCCAGAGTAGG - Intergenic
1171013760 20:21522454-21522476 GCTTCCTCCATCGCCACCGCCGG + Intergenic
1171015855 20:21541153-21541175 GAATCCTTCCTTGCCACAGATGG - Intergenic
1171878271 20:30598215-30598237 GCAGCCTCCCCATTCACAGCTGG + Intergenic
1172161992 20:32875282-32875304 GCATCCACCCCAGCCACCCCAGG - Intronic
1172782689 20:37446619-37446641 GCCTCAGCCCTGGCCACAGCAGG + Intergenic
1173024059 20:39291468-39291490 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1174487969 20:50873071-50873093 GCATCCTTCCTGGTCACAGAGGG - Intronic
1176267946 20:64220557-64220579 GAATCCTCCGAGGCCACAGCCGG + Intronic
1179462414 21:41546262-41546284 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1181794946 22:25300884-25300906 GTGTCCTCTATAGCCACAGCTGG + Intergenic
1183015159 22:34980161-34980183 GCTTCCTCCCTGGCAACAGCTGG + Intergenic
1183107374 22:35624221-35624243 GCAGCCTCCCGAGCCAGAGTAGG + Intronic
1183898432 22:40987654-40987676 GAATCCTTCCTCGCCCCAGCCGG + Intergenic
1185265859 22:49903663-49903685 GCCTCCTCCACAGCCTCAGCTGG - Exonic
950516940 3:13473160-13473182 TCATCTTCCCTAACCTCAGCTGG - Intergenic
950958353 3:17079205-17079227 GCATCCTCTCTCTACACAGCTGG + Intronic
951960247 3:28310202-28310224 GCACCCTCCCTGCCCAGAGCAGG + Intronic
952538761 3:34343915-34343937 GCACTCTAACTAGCCACAGCTGG + Intergenic
952951720 3:38531087-38531109 GCAGCCTCCCTGCCCACTGCTGG - Intronic
953849461 3:46454954-46454976 GCCGCCTGCCTAACCACAGCAGG - Intronic
954368625 3:50158807-50158829 GAATCCCCCATAGCCCCAGCAGG - Intronic
954566383 3:51603644-51603666 GCAGCCTTCCAAGCCACAGTAGG - Intronic
955263690 3:57420999-57421021 TCATCCTCATTAGCCATAGCGGG - Intronic
956870886 3:73416716-73416738 GCATATTCCCTAGCCCCAGTGGG + Intronic
959879658 3:111429079-111429101 GCACCCTCTGTAGCCAAAGCTGG - Intronic
961705823 3:128784449-128784471 GCATCCTCACTGTCCACCGCAGG + Intronic
962869300 3:139474323-139474345 GCATCCTCCCAACCCCCAGGAGG + Intronic
963383776 3:144564897-144564919 ACATTCTCTCTAGGCACAGCTGG - Intergenic
968724576 4:2238922-2238944 GCATTCTCTCTTACCACAGCAGG + Exonic
968735836 4:2296151-2296173 GCCTCCTCCCAATTCACAGCTGG - Intronic
970462571 4:16289898-16289920 TCATCCTCCTTAGGCACAGTTGG - Intergenic
971257563 4:25029164-25029186 CCATCCTTTCTGGCCACAGCAGG + Intronic
971376746 4:26061827-26061849 GACTCCTCCCTGGCCTCAGCAGG - Intergenic
973323311 4:48831635-48831657 GCATCCTTCCTAGAAACACCAGG - Intronic
973561638 4:52142983-52143005 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
974372043 4:61029789-61029811 TCACATTCCCTAGCCACAGCAGG - Intergenic
975707536 4:77126085-77126107 TCCTCTTCCCTATCCACAGCAGG + Intergenic
979207810 4:118061858-118061880 GCAGCCTCCCGAGCCAGAGTAGG + Intronic
984860578 4:184234427-184234449 GCAGCCTCCTGAGCCACAGTAGG - Intergenic
985766188 5:1780737-1780759 GCAGCCTTCCCAGCCATAGCAGG + Intergenic
989093432 5:37758345-37758367 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
989094170 5:37765910-37765932 GCAGCCTCCCAAGCCATAGTAGG + Intergenic
989601346 5:43203553-43203575 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
995340937 5:111058473-111058495 CCAGCCTCCCTAGCTCCAGCAGG + Intergenic
999032004 5:148304377-148304399 GCAGCCTCCCTAGCAAGAGTAGG + Intergenic
1001681243 5:173558496-173558518 GCATTCTTCATAGTCACAGCTGG - Intergenic
1001839712 5:174864812-174864834 CCAGCCTCCCTTGCCCCAGCAGG + Intergenic
1004399228 6:15273129-15273151 GCATCCTCCCCACCCACATGAGG - Intronic
1006068474 6:31479389-31479411 TCATCATCCCCAGCCCCAGCAGG + Intergenic
1006182881 6:32164497-32164519 GCCTCCTCCTTAGCTCCAGCAGG - Intronic
1006296277 6:33171474-33171496 CCATCCTCTCCAGCCACACCTGG + Exonic
1006632763 6:35441302-35441324 GCATCTTCACTAGCAAGAGCAGG + Intergenic
1007095024 6:39207739-39207761 GCATCCTTCCTTCCCACTGCTGG - Intronic
1008464611 6:51816814-51816836 GCAGCCTCCTGAGCCACAGTAGG - Intronic
1010243679 6:73642254-73642276 GCAGCCTCCCGAGCCATAGTAGG - Intronic
1010720378 6:79276769-79276791 GCTTCCTCATCAGCCACAGCTGG + Intergenic
1011057605 6:83222662-83222684 TCCTCCTCCCAAGCCTCAGCAGG - Intronic
1013121417 6:107144542-107144564 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1014561784 6:122899880-122899902 GAATCCTGCCTACCCACAGTAGG - Intergenic
1017053946 6:150421099-150421121 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1017725090 6:157271510-157271532 GGATCCTCCCCACCCACCGCTGG - Intergenic
1017786701 6:157762679-157762701 GCATCCTCCCTAGCCACAGCGGG - Intronic
1018138630 6:160804708-160804730 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1018948061 6:168359606-168359628 GCAGCCTCCCGAGCCAGAACAGG - Intergenic
1018984044 6:168622348-168622370 GCAGCCTCCCAAGCCAGAACAGG - Intronic
1019285328 7:220347-220369 GCAGCATCCCCAGCCACAGCAGG - Intronic
1019309254 7:352320-352342 GGATCCCCCCTAGCTACAGCCGG + Intergenic
1019515646 7:1438749-1438771 GCATCCTCCAAAGCCCCAGCAGG + Intronic
1020633799 7:10672236-10672258 CCAGCCTCCCTGGCCCCAGCAGG + Intergenic
1020836078 7:13153373-13153395 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1020866840 7:13575144-13575166 GCAGCCTCCCCAGCCAGAGTAGG + Intergenic
1021683418 7:23157815-23157837 TCATTCTCCATAGCCACAGCTGG + Intronic
1022636909 7:32144649-32144671 TGCTGCTCCCTAGCCACAGCAGG - Intronic
1023041231 7:36174918-36174940 GCAGCCTCCCAAGCCAGAGTAGG + Intronic
1024840666 7:53583539-53583561 GCAGCCTCCCAAGCCAAAGTAGG - Intergenic
1025786920 7:64652161-64652183 GCTTACTCTCTACCCACAGCTGG + Intergenic
1028291865 7:89075414-89075436 GCACCCTCTGAAGCCACAGCTGG - Intronic
1028749346 7:94365044-94365066 GCAGCCTCCCGAGCCAGAGTAGG - Intergenic
1031217857 7:118920701-118920723 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1031497868 7:122473354-122473376 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1032654304 7:133910922-133910944 GCATGGTCCCTGGACACAGCTGG - Intronic
1035495068 7:159317512-159317534 GCAGCCTCCCAAACCACAGCAGG - Intergenic
1036036923 8:5029814-5029836 GCATCTTACATAGCCAGAGCAGG - Intergenic
1036533006 8:9614343-9614365 GCATCTTCTCAAGCCATAGCTGG + Intronic
1037150014 8:15626021-15626043 CCAGCCTCCCTCGCCACAGCTGG - Intronic
1038454989 8:27667216-27667238 ACTTCCTCCCTAGCCAGACCAGG + Intronic
1040464389 8:47680364-47680386 GCATCCTGCCCAGTCACAGCTGG - Intronic
1040803222 8:51366442-51366464 GCAGCCTCCTGAGCCAGAGCAGG - Intronic
1041306088 8:56462562-56462584 GCATCATCCCTCCCCACTGCAGG - Intergenic
1042545951 8:69951630-69951652 GCAGCCTCCCGAGCCAGAGTAGG - Intergenic
1043910733 8:85860635-85860657 GCAGCCTCCCGAGCCAGAGTAGG + Intergenic
1044356160 8:91225019-91225041 CCAGCCTCCCTGGCCCCAGCAGG + Intronic
1046611383 8:116429454-116429476 ACATCTTCCATGGCCACAGCAGG + Intergenic
1047698579 8:127428031-127428053 GCCTCCTCACTGTCCACAGCAGG - Intergenic
1048502194 8:134988459-134988481 GCATCCTCCCCAGCCTCATTGGG + Intergenic
1049156955 8:141073128-141073150 GCAGCCTACCTGGCCCCAGCTGG + Intergenic
1049324973 8:142017080-142017102 GCATCCTCGCTTGGCACAGCTGG + Intergenic
1052382716 9:27789096-27789118 GAATCCCTTCTAGCCACAGCTGG - Intergenic
1055017056 9:71630080-71630102 GCATTCTCCTTAGCAACATCTGG - Intergenic
1055533446 9:77211543-77211565 GCAGCCTCCCAAGCCAGAGCAGG + Intronic
1055856359 9:80692457-80692479 GCATCTTACATAGCCAGAGCAGG - Intergenic
1056790141 9:89619990-89620012 GCCTCATCCCTGGCCACAGTTGG - Intergenic
1057585796 9:96327558-96327580 CCATCCTCCTTAGCAACAGATGG + Intronic
1057914231 9:99043330-99043352 GCCTCCTCCCAAGCCTGAGCTGG - Intronic
1058506608 9:105672991-105673013 GCAGCCTTCCGAGCCAGAGCAGG + Intergenic
1061304417 9:129724234-129724256 GCTTCCTCCCTGGCCGCAGCAGG + Intergenic
1061961245 9:133990433-133990455 CCATCTTCCCAAACCACAGCTGG + Intronic
1062610653 9:137371913-137371935 GCCGCCTCCCTACCCACTGCAGG + Intronic
1186390050 X:9149767-9149789 GCAGCCTCCCAAGCCAGAGTAGG - Intronic
1189274110 X:39772423-39772445 GCTTCCTCCCAACCAACAGCCGG + Intergenic
1189355126 X:40304634-40304656 GCGTCCTCCTTGGCCACAGGTGG - Intergenic
1190231682 X:48587121-48587143 GCAGCCTCCCAAGCCAGAGTAGG + Intergenic
1197030117 X:121803024-121803046 GCAGCCTCCCTGGCTCCAGCAGG + Intergenic
1198139652 X:133790012-133790034 GGTTCCTCCCCAGCCAAAGCTGG + Intronic
1198568492 X:137930704-137930726 GCAGGCTTTCTAGCCACAGCTGG + Intergenic
1198949444 X:142054117-142054139 GCAGCCTCCCAAGCCATAGTAGG + Intergenic
1199418028 X:147609241-147609263 GCAGCCTCCCAAGCCAGAGTAGG - Intergenic
1199872398 X:151911902-151911924 GGCTCCTCCCCAGCCAGAGCTGG - Intergenic
1200049662 X:153422037-153422059 GCCTCCTCCCTACCCGCAGCAGG - Intergenic