ID: 1017787184

View in Genome Browser
Species Human (GRCh38)
Location 6:157766206-157766228
Sequence CAAGTTCATCCCTTTGAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 370}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017787184_1017787192 23 Left 1017787184 6:157766206-157766228 CCCATTTCAAAGGGATGAACTTG 0: 1
1: 0
2: 0
3: 36
4: 370
Right 1017787192 6:157766252-157766274 TATAATATTGTGGACCAGGATGG 0: 1
1: 0
2: 0
3: 10
4: 138
1017787184_1017787191 19 Left 1017787184 6:157766206-157766228 CCCATTTCAAAGGGATGAACTTG 0: 1
1: 0
2: 0
3: 36
4: 370
Right 1017787191 6:157766248-157766270 TGTCTATAATATTGTGGACCAGG No data
1017787184_1017787188 13 Left 1017787184 6:157766206-157766228 CCCATTTCAAAGGGATGAACTTG 0: 1
1: 0
2: 0
3: 36
4: 370
Right 1017787188 6:157766242-157766264 GCCTCCTGTCTATAATATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017787184 Original CRISPR CAAGTTCATCCCTTTGAAAT GGG (reversed) Intronic
901252427 1:7790773-7790795 CAATTTCTCCCATTTGAAATGGG - Intronic
901896138 1:12313887-12313909 CAAGATCATCTCTTTGGAACTGG + Intronic
901925557 1:12563974-12563996 CAATTTCTCCCCTTTGGAATGGG + Intergenic
903188305 1:21641840-21641862 CATTTTCATACCTATGAAATGGG - Intronic
905701976 1:40023597-40023619 CCTGTTCATCCCTTTTGAATGGG + Intergenic
906813575 1:48854085-48854107 TTATTTCATCCCTATGAAATAGG + Intronic
906939559 1:50244370-50244392 CAAGGTGATCATTTTGAAATGGG - Intergenic
906992623 1:50755257-50755279 CAGTTTCTTCCCTTTGGAATGGG - Intronic
908733295 1:67249004-67249026 CAAGTTCATCCCATTGGGACTGG - Intronic
908812228 1:67994527-67994549 CAATTTCATTCCTTTGAAGGTGG - Intergenic
909024141 1:70463513-70463535 CAATTTCTCCCATTTGAAATGGG + Intergenic
909369815 1:74870650-74870672 CAGTTTCTTTCCTTTGAAATGGG + Intergenic
909439752 1:75684531-75684553 CAATTTCTCCACTTTGAAATTGG - Intergenic
909813321 1:79959185-79959207 CAATTTCTTCCATTTGGAATGGG - Intergenic
910395222 1:86786687-86786709 CAAATTCATCCTTTTGCAATTGG - Intergenic
910642635 1:89480439-89480461 CAATTTCTTCCATTTGGAATAGG - Intergenic
911128101 1:94360377-94360399 CAACTTTTTTCCTTTGAAATGGG + Intergenic
911150134 1:94590448-94590470 CAAGTTTATCATTTTGAACTAGG - Intergenic
911277398 1:95879086-95879108 CAATTTCTTCCATTTGTAATGGG - Intergenic
911628099 1:100150066-100150088 CAATTTCCTCCTTTTAAAATGGG + Exonic
911963693 1:104338378-104338400 CAGGTTCATCCCATTGAGATTGG - Intergenic
912055946 1:105597839-105597861 CAATTTCTTCCATTTGAAATGGG + Intergenic
917235543 1:172888306-172888328 CAATTTCTCCCTTTTGAAATGGG - Intergenic
917408685 1:174736241-174736263 CAATTTCTTCCTTTTGGAATGGG - Intronic
918167541 1:181964889-181964911 CAATTTCTCCCATTTGAAATGGG - Intergenic
920400449 1:205672941-205672963 CATGTTCACCCTTGTGAAATAGG + Intronic
921109257 1:212016229-212016251 CAAGTACATCCCTTTGACCCAGG - Intronic
921418495 1:214918810-214918832 CAGCTCCATCCCTTTAAAATGGG - Intergenic
921610482 1:217207082-217207104 CAATTTCTCCCATTTGAAATGGG + Intergenic
922089426 1:222381542-222381564 CACGTTCATACATTTGTAATGGG - Intergenic
922453935 1:225759111-225759133 CAAGTTCACCTCTATGAAAATGG - Intergenic
923428106 1:233892013-233892035 CAATTTCTTCCATTTGGAATAGG + Intergenic
1063734683 10:8739692-8739714 CAAGTTACTCCCATTGAAGTTGG + Intergenic
1063774489 10:9245853-9245875 TAAGTTAAAGCCTTTGAAATAGG + Intergenic
1063986401 10:11508296-11508318 AATCTTCATCCCTTTGAAATGGG + Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1065727628 10:28681159-28681181 AAAGTTCATGCCTTTGAATTTGG + Intronic
1067546151 10:47194022-47194044 CAAATTCCTCATTTTGAAATGGG - Intergenic
1067922838 10:50477329-50477351 CAATTTCTTCCTTTTGGAATGGG + Intronic
1069809894 10:71150561-71150583 AAAGTTCCTCCCTTTGACACAGG + Intergenic
1070202714 10:74223135-74223157 CAAGTGCAGCCCTTTGACCTTGG - Intronic
1070581698 10:77725227-77725249 CCAGTTTCTCCCTTTGGAATGGG + Intergenic
1070803772 10:79258570-79258592 CAACTTCACACCTATGAAATGGG - Intronic
1071350016 10:84731273-84731295 CCAGTTATTCCCTTTGAAAACGG + Intergenic
1072787474 10:98294042-98294064 CAAGCCCTTCCCTTTGAACTTGG - Intergenic
1074238044 10:111606177-111606199 CATGTTGCTCCCTGTGAAATGGG - Intergenic
1075022340 10:118960960-118960982 CAGGTGCACCCCTTTAAAATGGG + Intergenic
1077378959 11:2219253-2219275 CAATTTCTTCCTTTTGGAATGGG - Intergenic
1077979476 11:7285765-7285787 CAATTTCTCCCATTTGAAATGGG - Intronic
1078379622 11:10828712-10828734 CAATTTCTTCCATTTGGAATGGG - Intronic
1079769805 11:24444908-24444930 CAATTTCTTCCATTTGGAATGGG + Intergenic
1081588120 11:44401559-44401581 CAGGTTCAGCCCTTTAAACTTGG - Intergenic
1082023675 11:47555441-47555463 CAAGTTCCTCCCTTGCAAATGGG - Intronic
1082275192 11:50213730-50213752 CAACAGCATCCCTTTGAGATTGG - Intergenic
1085818936 11:79771236-79771258 CAATTTCTTCCTTTTGGAATGGG + Intergenic
1086323174 11:85671589-85671611 CAAGTTCTGCCATTTGGAATAGG - Intronic
1086829326 11:91540396-91540418 CAAATTCATGCCTTTGAGCTTGG + Intergenic
1087481576 11:98707697-98707719 CAAATTCAGTCCTTAGAAATAGG + Intergenic
1088072135 11:105800220-105800242 CATGTTTATACCTTTGACATTGG - Intronic
1089375357 11:117990015-117990037 AGGGGTCATCCCTTTGAAATGGG + Intronic
1090842855 11:130507834-130507856 CAATTTCACCCTTTTGGAATGGG + Intergenic
1091990262 12:4949487-4949509 AAAGTTCATACATTTGAGATGGG + Intergenic
1093037971 12:14351303-14351325 CAATTTCTTCCCTTTGGAACAGG - Intergenic
1094780733 12:33789433-33789455 CAATTTCTCCCATTTGAAATGGG - Intergenic
1094786810 12:33858778-33858800 CAATTTCTTCCATTTGGAATGGG - Intergenic
1095159740 12:38903150-38903172 CAAGTTAGTGCCTTTGGAATAGG - Intronic
1097444056 12:59646939-59646961 CAATTTCTTCCATTTGGAATGGG + Intronic
1097492766 12:60291135-60291157 CAATTTCTTCCTTTTGGAATGGG + Intergenic
1098247942 12:68539702-68539724 GAATTTGATTCCTTTGAAATTGG + Intergenic
1098327262 12:69315935-69315957 CAATTTCTCCCCTTTGGAATGGG - Intergenic
1098454599 12:70657966-70657988 TAAGTTCATCTTTCTGAAATAGG + Intronic
1099088711 12:78278808-78278830 CAATTTCACCCCTTTGGAATGGG + Intergenic
1099386517 12:82019289-82019311 CAATTTCTCCCATTTGAAATGGG + Intergenic
1099495763 12:83343833-83343855 CAACTTCTTTCTTTTGAAATGGG + Intergenic
1099565953 12:84246557-84246579 CAATTTATTCCATTTGAAATAGG + Intergenic
1099675563 12:85756108-85756130 CAATTTCTCCCATTTGAAATGGG + Intergenic
1099911368 12:88838475-88838497 CAATTTCTCCCATTTGAAATGGG - Intergenic
1100051952 12:90459988-90460010 CAATTTCTCCCATTTGAAATGGG + Intergenic
1100230245 12:92599859-92599881 CAATTTCTCCCATTTGAAATTGG - Intergenic
1100433039 12:94547326-94547348 CAAGAACATCCCAGTGAAATGGG + Intergenic
1100801196 12:98232882-98232904 CAATATCATCCCTTTGACAGGGG + Intergenic
1100872830 12:98929736-98929758 CAACTTCATTCCTTTGAATGTGG - Intronic
1100877370 12:98975964-98975986 CAAGTTCATGCTTTGGAATTGGG - Intronic
1101275786 12:103199253-103199275 CAATTTCATTCCTTTGAATGTGG - Intergenic
1101453912 12:104809426-104809448 AAAATTCATGCCTTTGGAATAGG - Intronic
1101595778 12:106163370-106163392 CCAGTTCATTCCTTTGAAAATGG - Intergenic
1105506724 13:21016578-21016600 CCAGTTCATTCCTTTAAAAACGG + Intronic
1105986132 13:25569500-25569522 CTAGTGCATCCCTTTTAAATAGG - Intronic
1106718866 13:32418852-32418874 CAATTTCTTCCATTTGGAATAGG + Intronic
1107296599 13:38915563-38915585 TAAGGGCATCCCTGTGAAATAGG - Intergenic
1107762345 13:43693907-43693929 CAAGTCCATCATTTTAAAATAGG + Intronic
1109285379 13:60402438-60402460 CCAGTACATCTCTTAGAAATAGG + Intronic
1109329322 13:60908362-60908384 AAAGTTCATCACTTTGATATAGG + Intergenic
1109406093 13:61902461-61902483 CAATTTGATCCATTTGATATTGG + Intergenic
1109574485 13:64235693-64235715 CAACTTCATGCTTTTGAATTTGG + Intergenic
1109610810 13:64762517-64762539 CAATTTCTTCCATTTGGAATAGG + Intergenic
1109715840 13:66220742-66220764 CATGTTCATTCCTTTTAAAGAGG - Intergenic
1110022385 13:70491153-70491175 CAATTTCTTCCATTTGGAATGGG + Intergenic
1110681752 13:78322086-78322108 CAAGGTCAGCCTTCTGAAATTGG - Intergenic
1110868344 13:80422469-80422491 CAATTTCTCCCCTTTGAAACAGG - Intergenic
1111221985 13:85217171-85217193 AAAGTTCATAGCTTTGAAATTGG + Intergenic
1111409157 13:87852164-87852186 CAAGTTCCTCACTTATAAATTGG - Intergenic
1111872664 13:93852973-93852995 CCATTTTATCCCCTTGAAATTGG - Intronic
1112739148 13:102454384-102454406 CAACTCCCACCCTTTGAAATAGG - Intergenic
1114647450 14:24263552-24263574 CAGGCTCAGCCCTATGAAATTGG + Intronic
1114680402 14:24479468-24479490 CAATTTCTCCCATTTGAAATGGG - Intergenic
1116064855 14:39970019-39970041 CAATTTCTCCTCTTTGAAATGGG + Intergenic
1116122501 14:40737922-40737944 CAATTTCTCCCATTTGAAATGGG + Intergenic
1116261099 14:42628255-42628277 CAAGTTCATCATTCTGAATTTGG - Intergenic
1118509254 14:66452339-66452361 CAAGTTTAACCATTTGGAATTGG + Intergenic
1118691571 14:68345033-68345055 CCAGTTTTTCCCTTTGGAATGGG + Intronic
1119833938 14:77730058-77730080 CAAGTACATGGCTCTGAAATGGG - Intronic
1120082946 14:80236382-80236404 CAATTTCTTCCATTTGGAATGGG - Intronic
1120270744 14:82310083-82310105 CAATTTCTTCCATTTGGAATGGG + Intergenic
1121721866 14:96115004-96115026 CAAGCTCATCCACTAGAAATGGG - Intergenic
1122154537 14:99742334-99742356 CCAGTTCATCCCTTGGGGATAGG + Intronic
1123155853 14:106225124-106225146 CAAGTTCCTCTCTTTTAAAATGG - Intergenic
1126190474 15:45873205-45873227 CAACTTCTCCCATTTGAAATGGG - Intergenic
1126474200 15:49049187-49049209 CAAGCTCATCCCTTGGAATGAGG + Intergenic
1127345085 15:58086913-58086935 AAAGTTGATCTATTTGAAATAGG - Intronic
1128634908 15:69297003-69297025 CCATTTCATCACTATGAAATAGG + Intergenic
1129991681 15:79970225-79970247 TAAGTTCATCGCTTACAAATTGG - Intronic
1131700843 15:94934255-94934277 CAACTTCTCCCTTTTGAAATGGG - Intergenic
1131784982 15:95902955-95902977 CAAATTGACCCCTTTGTAATAGG - Intergenic
1136663172 16:31783419-31783441 CAATTTCATTCACTTGAAATGGG - Intronic
1137047328 16:35679925-35679947 AAAGTTCAACTCTTTGAGATGGG - Intergenic
1139033240 16:62911247-62911269 CAATTTCTTTCATTTGAAATGGG - Intergenic
1143668572 17:8380426-8380448 CCATTTCATCTTTTTGAAATAGG + Intronic
1144281845 17:13734241-13734263 CAATTTCTTCCATTTGGAATGGG + Intergenic
1145258373 17:21340127-21340149 CAATCTCCTCCCTGTGAAATGGG + Intergenic
1145318255 17:21747879-21747901 CAATCTCCTCCCTGTGAAATGGG - Intergenic
1146451846 17:32981105-32981127 CAATTTCTTCCATTTGGAATGGG - Intronic
1147901279 17:43786783-43786805 TATGTTCATCCTTTTGAGATTGG + Exonic
1148800907 17:50225219-50225241 CAATTTCTCCCCTTTGGAATGGG - Intergenic
1148996723 17:51716629-51716651 CAAGTTCATACCTTGGTAAGTGG - Intronic
1149369364 17:55977988-55978010 CAATTTCCTCCATTTGGAATGGG - Intergenic
1150830805 17:68517920-68517942 CAAGTTCTCCCATTTGGAATGGG - Intronic
1150987490 17:70214363-70214385 CAATTTCTTCCATTTGGAATGGG + Intergenic
1155413447 18:25571142-25571164 CAATTTCTCCCATTTGAAATGGG - Intergenic
1156660547 18:39341177-39341199 CAACATCACCCCTTAGAAATAGG - Intergenic
1156904370 18:42336457-42336479 CAATTTCTCCCATTTGAAATGGG - Intergenic
1157195135 18:45614716-45614738 CAATTTCTCCCATTTGAAATGGG + Intronic
1158299157 18:56032883-56032905 CAAGGTCTCCCCTTTGGAATGGG - Intergenic
1158374550 18:56848280-56848302 CAATTTCTTCCTTTTGGAATGGG + Intronic
1158765834 18:60448521-60448543 CAATTTCTTCCTTTTGGAATGGG - Intergenic
1159071031 18:63624396-63624418 CAATTTCTTCCTTTTGGAATGGG - Intergenic
1159261243 18:66015929-66015951 CAATTTCTACCATTTGAAATGGG - Intergenic
1159430268 18:68342881-68342903 CAATTTCCTCCCTTGGAAATTGG - Intergenic
1159620076 18:70627049-70627071 CAAGTCAATACCTTTTAAATTGG + Intergenic
1159732652 18:72049787-72049809 CAATTTCATTCTTTTGAAAGTGG - Intergenic
1165985668 19:39766845-39766867 CAATTTCAGCCCTTTGGAAACGG + Intergenic
1166439317 19:42797518-42797540 CTATTTCTTCCCTTTGGAATGGG - Intronic
1166457355 19:42953066-42953088 CTAATTCTTCCCTTTGGAATGGG - Intronic
1166467686 19:43047496-43047518 CTATTTCTTCCCTTTGGAATGGG - Intronic
1166474303 19:43108286-43108308 CTATTTCTTCCCTTTGGAATGGG - Intronic
1166488268 19:43233362-43233384 CTATTTCTTCCCTTTGGAATGGG - Intronic
1166494942 19:43293840-43293862 CTATTTCTTCCCTTTGGAATGGG - Intergenic
1166840202 19:45692628-45692650 CAAGTTCCTCCCCATGGAATCGG - Exonic
1167694774 19:51009054-51009076 CAAGTTCAACTCTTAGAAGTAGG - Intronic
1168151698 19:54452544-54452566 CAGTTTCATCCCTTGGCAATTGG + Intronic
1168655290 19:58123131-58123153 CAAGTTCTCCCTTTTGGAATAGG - Intergenic
925737920 2:6980419-6980441 CAAGTTCTCCCATTTGAAATGGG - Intronic
926375597 2:12224210-12224232 CAATTTCTTCCATTTGGAATGGG + Intergenic
926991778 2:18688044-18688066 CAATTTCAGACCTTTGAAATTGG + Intergenic
927170790 2:20367717-20367739 CAATTTCTCCCTTTTGAAATGGG - Intergenic
928920813 2:36525294-36525316 CAAGTTCATGACTATGATATAGG + Intronic
929798962 2:45083089-45083111 CATTTACAGCCCTTTGAAATCGG - Intergenic
929853839 2:45618718-45618740 CAATTTCATCCTCTTAAAATGGG - Intergenic
930307787 2:49697962-49697984 CAATTCCCTCCCTATGAAATGGG - Intergenic
930813007 2:55561735-55561757 CAATTTCTTCCATTTGGAATGGG + Intronic
930960426 2:57253694-57253716 CAATTTCTTCCATTTGGAATGGG + Intergenic
931021547 2:58050002-58050024 CAAGTTCAAACCCTTTAAATGGG - Intronic
931485857 2:62690807-62690829 CAAAATCCTTCCTTTGAAATAGG - Intronic
931905157 2:66834613-66834635 CAAGTTCATTCTTTAGAAAAAGG - Intergenic
931967041 2:67545934-67545956 CAATTTCTTCCATTTGGAATGGG - Intergenic
934118336 2:88816271-88816293 CAATTTCTTCCATTTGGAATGGG + Intergenic
936736325 2:115447228-115447250 CAATTTCTCCCATTTGAAATGGG + Intronic
937578581 2:123455460-123455482 CAAGTTCATCTCTTTCTTATGGG + Intergenic
938750536 2:134324819-134324841 AATGTTCAGCCATTTGAAATGGG + Intronic
940785916 2:157980870-157980892 CAATTTCTTCCATTTGGAATAGG + Intronic
941888461 2:170553480-170553502 CAATTTCTTCCTTTTGGAATGGG + Intronic
943153879 2:184148999-184149021 CAATTTCTCCCTTTTGAAATGGG - Intergenic
943372189 2:187028814-187028836 CAACTTCTCCCATTTGAAATGGG + Intergenic
943492389 2:188571308-188571330 CAAGCTCATCACTATGAAAAAGG + Intronic
944021905 2:195115151-195115173 CAATTTCTTCCATTTGAAATGGG + Intergenic
944907313 2:204275440-204275462 TAATTTCATCCTTTTGAAATAGG + Intergenic
945372062 2:209031247-209031269 CAATTTCTCCCATTTGAAATGGG - Intergenic
945618781 2:212107401-212107423 CAATTTCTCCCATTTGAAATGGG + Intronic
946055756 2:216900718-216900740 CAATTTCTCCCCTTTGGAATGGG - Intergenic
947003036 2:225479248-225479270 CAAATCCATCCCTTTGAATTTGG + Intronic
947375865 2:229494405-229494427 CTAGTTCTTCCTTTTGGAATGGG - Intronic
948297661 2:236874997-236875019 CAAGTTCTTCCCGCTGTAATTGG + Intergenic
949017508 2:241721805-241721827 TAAGTGCATCCCTTTCAAACAGG + Intronic
1169412359 20:5382450-5382472 CAAGTTCAGCCCCAGGAAATGGG - Intergenic
1169904483 20:10587792-10587814 CAAGTTCATTCTTTTGCATTTGG - Intronic
1172243730 20:33431416-33431438 CAATGTCATCCCTGTGAATTAGG - Intronic
1173438005 20:43050026-43050048 CACTTCCTTCCCTTTGAAATGGG - Intronic
1174661881 20:52220756-52220778 CAATTTCTCCCCTTTGGAATGGG - Intergenic
1175142313 20:56870131-56870153 CCAGTTCTGCCCTTTGACATAGG + Intergenic
1176690552 21:9903516-9903538 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1177244128 21:18500460-18500482 CAATTTCTTCCTTTTTAAATTGG - Intergenic
1177312371 21:19413690-19413712 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1177606102 21:23379433-23379455 CAATTTCTCCCATTTGAAATGGG + Intergenic
1178218179 21:30624974-30624996 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1178494172 21:33072713-33072735 CAACTTCATCCCCTGGAAAATGG + Intergenic
1182279287 22:29208720-29208742 CAAGGTCTTCCCCTTGGAATAGG - Intronic
1182389169 22:29976580-29976602 CAAGGTCATTCTTATGAAATTGG + Intronic
1182945394 22:34316792-34316814 CAAGTTCTCCCTTTTGGAATGGG + Intergenic
1183847466 22:40554054-40554076 CAATTTCTCCCCTTTGGAATGGG + Intronic
950353561 3:12382090-12382112 CAAGGTCATCCCTTAGTAAGTGG + Intronic
950622870 3:14220493-14220515 TAATTTCATCCCATTGAGATTGG + Intergenic
952022548 3:29040755-29040777 CAATTTCTCCCATTTGAAATGGG + Intergenic
953379294 3:42454944-42454966 CAATTTCTTCCATTTGGAATTGG - Intergenic
953573236 3:44089806-44089828 CAAGTTCATCCACTTGAAAGTGG - Intergenic
956872314 3:73430144-73430166 CAGTTTCTTCTCTTTGAAATAGG + Intronic
958796329 3:98710106-98710128 CAAGTTCATCCCCTTCCAACTGG - Intergenic
958935381 3:100250638-100250660 CAATTTCTTCCATTTGGAATGGG - Intergenic
959403071 3:105926827-105926849 CAAATTCTTCCATATGAAATAGG + Intergenic
959827412 3:110814952-110814974 CAAGAACATTTCTTTGAAATGGG - Intergenic
960478235 3:118157845-118157867 CAAGTTCTCCCATTTGGAATTGG - Intergenic
960929472 3:122830609-122830631 CAAATTCATTCTTTTGAATTTGG - Intronic
961859364 3:129902356-129902378 CAAGGTTATCCTTTTGTAATGGG + Intergenic
961980886 3:131077028-131077050 TAATTTCATTCCCTTGAAATTGG - Intronic
962421505 3:135233279-135233301 CCATTTCTTCCCTTTGGAATGGG - Intronic
963593538 3:147295659-147295681 CACTTTCTTCTCTTTGAAATGGG - Intergenic
964966096 3:162495651-162495673 CAAGTTCTCCCATTTGGAATGGG - Intergenic
965012061 3:163107006-163107028 CAATTTCTCCCATTTGAAATGGG - Intergenic
965036984 3:163451767-163451789 CAATTTCTTCCATTTGGAATGGG + Intergenic
965404786 3:168255424-168255446 CAACTTCTCCCATTTGAAATGGG - Intergenic
965869852 3:173252591-173252613 CAATTTCTTCCTTTTGGAATGGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
967453432 3:189652404-189652426 CAATTTCTCCCATTTGAAATGGG + Intronic
967559995 3:190906186-190906208 CAATTTCTCCCATTTGAAATGGG + Intergenic
967870552 3:194225537-194225559 CATTTTCTTGCCTTTGAAATGGG + Intergenic
968380593 4:92650-92672 CAATTTCTCCCATTTGAAATGGG - Intergenic
970061606 4:12039914-12039936 CAATTTCTTCCATTTGGAATGGG + Intergenic
970165433 4:13232179-13232201 CAATTTCTTCCATTTGAAATGGG - Intergenic
970189034 4:13492888-13492910 CAAATTCAGCCCTTTGACCTTGG - Intergenic
970262101 4:14236545-14236567 CAAGTTCTACCTTTTGACATAGG - Intergenic
970730322 4:19095727-19095749 CAATTTCATCTCTATGAAGTAGG - Intergenic
970744722 4:19281223-19281245 CAATTTCTCCCATTTGAAATGGG - Intergenic
973047187 4:45549335-45549357 CTATTTCTCCCCTTTGAAATGGG + Intergenic
973102196 4:46287151-46287173 CAACTTCATTCTTTTGAATTTGG + Intronic
974177729 4:58345427-58345449 CAATTTCTTCCATTTGGAATGGG + Intergenic
974248963 4:59360336-59360358 CAATTTCTTCCATTTGAAGTGGG + Intergenic
974508961 4:62811897-62811919 CAATTTCATCACTTTTAAAGTGG - Intergenic
974876549 4:67710035-67710057 CAATTTCTTCCATTTGAAATGGG - Intergenic
976955237 4:90888679-90888701 CAAGTTAAGTCCTTTGAAAGTGG + Intronic
977041219 4:92021679-92021701 CAAGTTCAACCTTTTATAATAGG + Intergenic
977416064 4:96733981-96734003 CCAGTTTCTCCCTTTGGAATGGG + Intergenic
977471447 4:97448122-97448144 CAATTTCTCCCATTTGAAATGGG + Intronic
978210787 4:106132878-106132900 CAATTTCTCCCCTTTGGAATGGG + Intronic
979412458 4:120395731-120395753 CAATTTCTCCCATTTGAAATGGG - Intergenic
979610291 4:122682411-122682433 CAATTTCTGCCCTTTGGAATGGG + Intergenic
980353951 4:131721439-131721461 CAATTTCTCCCTTTTGAAATGGG - Intergenic
980391660 4:132155478-132155500 TAAGTACAGCCATTTGAAATGGG + Intergenic
981191658 4:141871927-141871949 CAATTTCTTCCATTTGGAATGGG - Intergenic
981821981 4:148897642-148897664 CAATTTCTCCCATTTGAAATGGG - Intergenic
981952815 4:150430803-150430825 CCAGTTCATTACTTTGGAATGGG - Intronic
981981409 4:150796285-150796307 CAAGTTGACCTCTTTGAATTAGG + Intronic
982098757 4:151947573-151947595 CAATTTCTTCCATTTGGAATGGG + Intergenic
982419276 4:155175903-155175925 AAAGATCATGCCATTGAAATGGG + Intergenic
982448741 4:155526695-155526717 AAAGTTCATCCAATTAAAATAGG + Intergenic
982805336 4:159755665-159755687 CAATTTCTTCCTTTTGAAATGGG + Intergenic
983417772 4:167480296-167480318 CAATTTCTGCCATTTGAAATGGG + Intergenic
983736577 4:171069846-171069868 CAATTTCTCCCATTTGAAATGGG - Intergenic
984116126 4:175683258-175683280 CAATTTCTTCCTTTTGGAATGGG + Intronic
984116537 4:175688272-175688294 AAAGTTCATACCTTTGATCTTGG - Intronic
984316764 4:178139591-178139613 CATGCTCATCCATTTCAAATGGG - Intergenic
984889576 4:184479002-184479024 AAAGTTGACCCCTTTCAAATGGG + Intergenic
985373801 4:189313700-189313722 CAATTTCATTCTTTTGGAATGGG - Intergenic
985482485 5:124173-124195 CAACTTCATCCCTTTGTGATCGG + Intergenic
985596679 5:794917-794939 CAATTTCTTCCTTTTGGAATAGG + Intergenic
986167314 5:5286114-5286136 CTAGTTCATCCCATTTAAATGGG - Intronic
986496154 5:8344086-8344108 CAATTTCTTCCATTTGGAATGGG - Intergenic
986601636 5:9478647-9478669 CAAGTTCTCCCTTTTGGAATGGG + Intronic
986970221 5:13325939-13325961 CATCTACATTCCTTTGAAATTGG - Intergenic
987000152 5:13651931-13651953 TAAGTACATCCATTTCAAATGGG - Intergenic
987116922 5:14732990-14733012 CAAGTTCCCTCCTTTGAAACTGG - Intronic
988034140 5:25803776-25803798 CCATTTCTTCCATTTGAAATGGG - Intergenic
988819706 5:34869520-34869542 CAAGGTCATCTTTTTGAAAGTGG + Intronic
989101175 5:37824587-37824609 CAAAGTCATCACTTTGAAATAGG - Intronic
989224641 5:39011766-39011788 CAATTTCTCCCCTTTGGAATGGG + Intronic
989651526 5:43696214-43696236 CAATTTCTCCCATTTGAAATGGG - Intronic
990742103 5:58922693-58922715 CAAGGTCATCCCTGGGACATCGG - Intergenic
993066984 5:83113156-83113178 CAATTTCTCCCATTTGAAATGGG - Intronic
993107208 5:83612741-83612763 TAATTTCTTCCTTTTGAAATGGG + Intergenic
993690798 5:90996927-90996949 CAATTTCTTCCTTTTGGAATGGG + Intronic
993999340 5:94760216-94760238 CAATTTCTTCCCTTTCTAATGGG - Intronic
994878818 5:105460490-105460512 CAATTTCTCCCATTTGAAATGGG - Intergenic
995262013 5:110115092-110115114 CACGTTCATCTCTATGAAAAAGG + Intergenic
995997781 5:118322265-118322287 CAATTTCTTCCATTTGGAATGGG - Intergenic
996468079 5:123826259-123826281 CAATTTCTTCCATTTGGAATGGG + Intergenic
996480831 5:123973408-123973430 CAATTTCTCCCTTTTGAAATGGG - Intergenic
997091492 5:130864098-130864120 CAATTTCTCCCATTTGAAATGGG - Intergenic
997497701 5:134344095-134344117 CAAGTTCATTCTTTTGCATTTGG - Intronic
997801723 5:136869507-136869529 CAAGTTCATTCTTGTTAAATAGG - Intergenic
999068496 5:148717035-148717057 CAATTTCTTTCATTTGAAATGGG + Intergenic
1003337031 6:5183488-5183510 CAAGTTCATTCCTTTTGAATAGG - Intronic
1003720229 6:8693279-8693301 CAATTTCTCCCATTTGAAATGGG + Intergenic
1004805640 6:19201304-19201326 CAATTTCTCCCATTTGAAATGGG - Intergenic
1008099126 6:47372368-47372390 CAATTTCTTCCTTTTGGAATGGG + Intergenic
1008506358 6:52234624-52234646 CAAGTTCATGACTTTGATAAGGG - Intergenic
1008658449 6:53641026-53641048 AAAGTTCATTGCTTTGAAAATGG + Intergenic
1009309718 6:62134835-62134857 CAATTTCTCCCATTTGAAATGGG + Intronic
1009559586 6:65221987-65222009 CAATTTCTCCCATTTGAAATGGG + Intronic
1010167069 6:72928138-72928160 CATGTTCATCTCTTTAACATGGG + Intronic
1010458109 6:76082419-76082441 CAATTTCTCCCATTTGAAATGGG - Intergenic
1010529899 6:76955257-76955279 AAAGTTCACCCCTTGAAAATAGG + Intergenic
1011738180 6:90333464-90333486 CAATTTCTCCCATTTGAAATGGG - Intergenic
1011955879 6:93025112-93025134 CAATTTCTTCCTTTTGGAATGGG - Intergenic
1012967218 6:105687615-105687637 CAATTTCTTCCATTTGGAATGGG + Intergenic
1013213593 6:108007881-108007903 CAATTTCTCCCATTTGAAATGGG - Intergenic
1013927652 6:115492909-115492931 CAATTTCTTCCATTTGGAATGGG - Intergenic
1014591470 6:123277058-123277080 CAATTTCTTCCCTTTAAAAGGGG + Intronic
1015881661 6:137876027-137876049 CAATTTCGCCCCTTTGAAAGTGG + Exonic
1015994673 6:138986227-138986249 CAAATTCATCCTGTTGAAAAGGG - Intronic
1016124554 6:140384819-140384841 CAATTTCTCCCATTTGAAATGGG - Intergenic
1016613823 6:146024553-146024575 CAACTTCTTCCATTTGGAATGGG + Intergenic
1017283145 6:152644863-152644885 TATGTTCATCCCTTTTAAAATGG + Intergenic
1017787184 6:157766206-157766228 CAAGTTCATCCCTTTGAAATGGG - Intronic
1018510150 6:164516357-164516379 CAATTTCTTCCATTTGGAATGGG - Intergenic
1019084929 6:169466988-169467010 CAATTTCTTCCATTTGAAATGGG - Intronic
1020846580 7:13292429-13292451 CAATTTCTTTTCTTTGAAATAGG + Intergenic
1021190160 7:17611065-17611087 GAAGATCATCCCTGTGAAATGGG - Intergenic
1021214257 7:17897095-17897117 AAAGTTCATACCTTTGGAAATGG + Intronic
1022146493 7:27547200-27547222 CAAGTTCAAGGCTTTGAGATGGG - Intronic
1022352381 7:29578095-29578117 CAATTTCTCCCATTTGAAATGGG + Intergenic
1022833084 7:34087809-34087831 TCAATACATCCCTTTGAAATGGG - Intronic
1024083902 7:45878000-45878022 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1024322368 7:48084101-48084123 CCAGTTAATCTCTTTAAAATTGG - Intergenic
1024523310 7:50326739-50326761 CAAATTCTTCTCTTTGAAATAGG - Intronic
1025163060 7:56682870-56682892 CAATTTCTCCCATTTGAAATGGG - Intergenic
1028862684 7:95671609-95671631 GAACTTCATCCCTTTTTAATAGG + Intergenic
1030395487 7:108981175-108981197 CAAGTGAACCCCTTTGGAATGGG - Intergenic
1030516902 7:110550337-110550359 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1031608317 7:123795156-123795178 CAATTTCTTCCATTTGGAATGGG + Intergenic
1031803217 7:126275331-126275353 CAATTTCTCCCATTTGAAATGGG - Intergenic
1032946480 7:136859139-136859161 CCAGTTCATTCCATTGTAATAGG + Intergenic
1033032210 7:137837978-137838000 AAAGTTTCTCCCTTTTAAATTGG - Intronic
1033507444 7:142019591-142019613 CAAGTTTATCCCTTTTAAAGTGG + Intronic
1033610440 7:142959339-142959361 CAAGTTGATCCATTCCAAATTGG - Intronic
1034743002 7:153495668-153495690 CAATTTCTTCCATTTGGAATGGG + Intergenic
1034751394 7:153572029-153572051 CAATTTCTTCCATTTGGAATGGG + Intergenic
1035180414 7:157085243-157085265 CAATTTCTTCCCTTTGGAATGGG + Intergenic
1037746523 8:21649908-21649930 CAATTTCTTCCTTTTGAGATGGG - Intergenic
1041927680 8:63253028-63253050 CAATTTCTTCCATTTGAAACAGG + Intergenic
1043266199 8:78270438-78270460 CAATTTCTTCCATTTGAAATGGG - Intergenic
1044126983 8:88471384-88471406 CAATTTCTTTCATTTGAAATAGG - Intergenic
1044188527 8:89284411-89284433 CAATTTCTTCCATTTGGAATGGG + Intergenic
1044324751 8:90847179-90847201 CAATTTCTCCCATTTGAAATGGG - Intronic
1044944677 8:97379282-97379304 CCAGTGCAGCCCTTTGAAGTCGG + Intergenic
1045993638 8:108338810-108338832 CAATTTCTCCCCTTTGGAATGGG - Intronic
1046260946 8:111766419-111766441 CCAGTTCCTCCTATTGAAATGGG - Intergenic
1047499059 8:125428690-125428712 CAGTTTCTTCCCTGTGAAATGGG + Intergenic
1048694677 8:137012739-137012761 CAATTTCTCCCATTTGAAATGGG - Intergenic
1050026255 9:1337329-1337351 CAAGTTCACCTCTCTGAACTTGG + Intergenic
1051267619 9:15323840-15323862 CAATTTCTCCCATTTGAAATAGG + Intergenic
1052008941 9:23383296-23383318 CAATTTCTCCCCCTTGAAATGGG + Intergenic
1052628236 9:31004552-31004574 CAAGTTCATCTCATTGAGACTGG + Intergenic
1053627277 9:39888030-39888052 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1053778716 9:41577995-41578017 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1054166678 9:61788235-61788257 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1054216610 9:62362673-62362695 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1054670872 9:67792670-67792692 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1055578121 9:77680183-77680205 CAACTTCATGCCTCTGCAATTGG + Intergenic
1056089533 9:83191344-83191366 CCAGTTCATCACTCTGTAATAGG - Intergenic
1056149020 9:83765753-83765775 CAATTTCTCCCATTTGAAATGGG + Intronic
1058393579 9:104524544-104524566 CAATTTCTTCCATTTGGAATGGG - Intergenic
1059601501 9:115783817-115783839 CAATTTCTTCCATTTAAAATGGG + Intergenic
1059802810 9:117767846-117767868 CAAGTTCCTCCCTGTAAAATGGG + Intergenic
1062438908 9:136560431-136560453 CAATTTCTCCCTTTTGAAATGGG + Intergenic
1185934612 X:4241592-4241614 CAAGTGCATGCCTTAGCAATGGG - Intergenic
1186807632 X:13155860-13155882 CAATTTCTTCCATTTGGAATGGG - Intergenic
1186976090 X:14906386-14906408 CAACTTCATTCCTTTGAATGTGG - Intronic
1187825061 X:23326819-23326841 CAATTTCCTCTCTTTAAAATGGG + Intergenic
1188651010 X:32632120-32632142 CAATTTCACCCTTTTGGAATAGG - Intronic
1188856940 X:35208658-35208680 CAATTTCTTCCTTTTGGAATGGG - Intergenic
1189604318 X:42660323-42660345 CAATTTCTTTCCTTTGGAATGGG + Intergenic
1189923770 X:45931332-45931354 CAGTTTCAACCCTTTGAGATGGG + Intergenic
1190428203 X:50352381-50352403 GAAATTCCTACCTTTGAAATTGG + Intergenic
1190512800 X:51191591-51191613 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1190947853 X:55113354-55113376 CAAGTTTAGGCCTTTGAATTAGG + Intronic
1191095156 X:56665744-56665766 CAATTTCTTCCATTTGGAATGGG + Intergenic
1192229794 X:69256976-69256998 GAAGTTCATCGCTTTGAAGCTGG + Intergenic
1192679591 X:73238133-73238155 TAAGTTCATCCCTTTGTCAAAGG + Intergenic
1193066468 X:77265355-77265377 CAATTTCTCCCATTTGAAATGGG + Intergenic
1193387227 X:80886002-80886024 CAAGTTCTTCCAATTGAAATGGG - Intergenic
1193509062 X:82377517-82377539 CAATTTCTTCCTTTTGGAATGGG - Intergenic
1193564077 X:83055998-83056020 CAATTTCTCCCTTTTGAAATGGG - Intergenic
1194253901 X:91613228-91613250 CAATTTCTCCCATTTGAAATGGG - Intergenic
1194535089 X:95096183-95096205 CAATTTCTCCCATTTGAAATGGG + Intergenic
1194779916 X:98011383-98011405 CAATTTCTCCCATTTGAAATGGG + Intergenic
1194860265 X:98990798-98990820 CAATTTCTGCCATTTGAAATGGG - Intergenic
1194886198 X:99318755-99318777 CAATTTCTTCCATTTGGAATGGG + Intergenic
1194903738 X:99547417-99547439 CAAGTTCATCCCTTTGTATGTGG - Intergenic
1196015884 X:110939422-110939444 CAATTTCTTCCTTTTGGAATAGG + Intergenic
1196223476 X:113138910-113138932 CAATTTCTCCCATTTGAAATGGG - Intergenic
1196313417 X:114196114-114196136 CAATTTCTTCCATTTGAAATGGG - Intergenic
1197119205 X:122870105-122870127 CAAGTTCGTAACTTTGAATTTGG + Intergenic
1198188568 X:134280752-134280774 CAATTTCTCCCATTTGAAATGGG + Intergenic
1198751778 X:139943466-139943488 CATGTTCTTCCCTGGGAAATGGG - Intronic
1199338115 X:146643129-146643151 CAATTTCTCCCATTTGAAATGGG + Intergenic
1199429708 X:147745367-147745389 GAAGTTTACCCCTATGAAATTGG - Intergenic
1200572686 Y:4852805-4852827 CAATTTCTCCCATTTGAAATGGG - Intergenic
1202283060 Y:23210173-23210195 CAATTTCACCCATTTGGAATGGG + Intergenic
1202434734 Y:24824558-24824580 CAATTTCACCCATTTGGAATGGG + Intergenic