ID: 1017788143

View in Genome Browser
Species Human (GRCh38)
Location 6:157773302-157773324
Sequence CACTGTGTCCACAGTGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017788143_1017788147 4 Left 1017788143 6:157773302-157773324 CCAGCTACACTGTGGACACAGTG 0: 1
1: 0
2: 3
3: 11
4: 160
Right 1017788147 6:157773329-157773351 GGTCCCAGCCCACTGCACAGAGG 0: 1
1: 0
2: 3
3: 24
4: 257
1017788143_1017788152 13 Left 1017788143 6:157773302-157773324 CCAGCTACACTGTGGACACAGTG 0: 1
1: 0
2: 3
3: 11
4: 160
Right 1017788152 6:157773338-157773360 CCACTGCACAGAGGCAGCCGAGG 0: 1
1: 0
2: 1
3: 29
4: 308
1017788143_1017788153 21 Left 1017788143 6:157773302-157773324 CCAGCTACACTGTGGACACAGTG 0: 1
1: 0
2: 3
3: 11
4: 160
Right 1017788153 6:157773346-157773368 CAGAGGCAGCCGAGGTGCAGAGG 0: 1
1: 1
2: 5
3: 57
4: 517

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017788143 Original CRISPR CACTGTGTCCACAGTGTAGC TGG (reversed) Intronic
900265716 1:1756064-1756086 CACTGTGTCCACACTGCCCCTGG + Intronic
901916075 1:12501687-12501709 CAGTGCGTTCACAGTTTAGCAGG + Intronic
902786508 1:18735825-18735847 CACGGGGTCCACGCTGTAGCCGG - Exonic
904314417 1:29651051-29651073 TACTGTGGCCAGAGTGGAGCTGG - Intergenic
906320125 1:44810488-44810510 CCCTGTGCCCACAGTGTAATGGG - Intronic
906607761 1:47183488-47183510 CCCTGTGCCCACAGGGCAGCTGG - Intergenic
907482687 1:54755488-54755510 CTCTGGGTCCACTTTGTAGCTGG - Intergenic
907744367 1:57198310-57198332 CAAGGAGTTCACAGTGTAGCAGG + Intronic
908801467 1:67885004-67885026 TTCAGTGTCCACAGGGTAGCTGG + Intergenic
909238951 1:73187851-73187873 CACTGTCTCCTCACTGAAGCAGG + Intergenic
910361979 1:86422130-86422152 CACTGTGTCTTCAGAGTAGAAGG - Intergenic
914338489 1:146738543-146738565 CACTGTGTGCACAGTGTGTGGGG + Intergenic
916171047 1:162002018-162002040 CCCTGTGTCCACAGTGTGGCGGG + Intronic
917895725 1:179484935-179484957 CACTGTGCCAACAGTGCTGCTGG + Intronic
919710778 1:200726055-200726077 CACTGTTTCCATAGTATAGTTGG + Intergenic
920539767 1:206769553-206769575 CACTGTGTTCACAGGCTGGCCGG + Intronic
1063094592 10:2898571-2898593 CCCTGTGTCCTCAGTGTTGGAGG - Intergenic
1066110271 10:32189377-32189399 CCCTCTGTCTACAGAGTAGCTGG - Intergenic
1067895110 10:50170495-50170517 CACTGTCTTCACAGGGTGGCAGG - Intergenic
1070719187 10:78744732-78744754 CGCTGTGACTACATTGTAGCTGG - Intergenic
1071430818 10:85605185-85605207 CACTGTATCCACAGTTTAACAGG - Intronic
1072639885 10:97203942-97203964 CACTGAGTGCCCAGTGGAGCTGG + Intronic
1072760596 10:98053355-98053377 CACTGCTTCCACAGTATAGTAGG - Intergenic
1073012357 10:100371407-100371429 CTCTGTGGCCAGGGTGTAGCTGG - Intergenic
1073573785 10:104603608-104603630 CAATATGACCACTGTGTAGCTGG - Intergenic
1076323840 10:129604963-129604985 CACTGTCTCTGCTGTGTAGCAGG + Intronic
1076878160 10:133227015-133227037 AACTCTGACCACAGTGGAGCAGG + Intergenic
1077832355 11:5887602-5887624 AATAGTGTCCACAGTGTAGATGG + Intronic
1078421464 11:11216368-11216390 CACTGTGGGCAAAGTGTGGCAGG + Intergenic
1081841417 11:46204194-46204216 ACCTGTGTCCACAGTCTAACAGG + Intergenic
1084751651 11:71208173-71208195 CACTGTGCACCCAGTGTGGCAGG + Intronic
1085553748 11:77400498-77400520 CACTGAGTCCTCAGTGCAGATGG - Intronic
1088225445 11:107615102-107615124 CACTATGTCTAGAGCGTAGCAGG + Intronic
1088457789 11:110050460-110050482 CACTGGGTCCACAGTGTTGGGGG + Intergenic
1090234638 11:125138650-125138672 CAGTGTGTCCCAACTGTAGCTGG - Intergenic
1091043053 11:132300472-132300494 CACTGCCCCCACAGTGCAGCCGG + Intronic
1094037877 12:26090108-26090130 CAGTGTCCCCACTGTGTAGCTGG + Intergenic
1095630142 12:44366811-44366833 CACTGTGTCTTGAATGTAGCAGG - Intronic
1098442038 12:70529152-70529174 CACAGTGTCCTCAGTGAGGCAGG + Intronic
1103401383 12:120645437-120645459 CACTTTGTCCACTGTGCAGTGGG - Intronic
1104642736 12:130477880-130477902 CCCTGTGGCCAGAGTGCAGCTGG - Intronic
1105892436 13:24691095-24691117 CACTTTGTTCACATTGTGGCAGG + Exonic
1106610667 13:31276479-31276501 CAGTCCGTGCACAGTGTAGCAGG + Intronic
1107461698 13:40610107-40610129 CAGCGTGTCCTCAGTGTCGCAGG - Intronic
1109058520 13:57582571-57582593 CATTGGATCCTCAGTGTAGCTGG - Intergenic
1110423769 13:75341953-75341975 CAGTGTGGCCACAGTATGGCAGG + Intronic
1111081801 13:83321238-83321260 CACTTTCTTCACAATGTAGCAGG + Intergenic
1115587713 14:34831427-34831449 CACTGTCTCCTCCATGTAGCAGG - Intronic
1120286072 14:82503615-82503637 CACATTGTACACATTGTAGCAGG + Intergenic
1120898028 14:89551705-89551727 CACAGTGTCCAGTATGTAGCAGG + Intronic
1124270267 15:28274337-28274359 CACCGTGTCCTCTGTGTGGCTGG - Exonic
1124882811 15:33658115-33658137 GAGTCTGGCCACAGTGTAGCTGG + Intronic
1125726598 15:41871412-41871434 CACTGTGCCCACGCTCTAGCAGG + Exonic
1126559759 15:50030488-50030510 CATTCTGTGCTCAGTGTAGCTGG - Intronic
1127453535 15:59138597-59138619 CACTGTGTCCCCAGCATAGAAGG + Intronic
1127785992 15:62355131-62355153 CACTGGGTGCAGAGTGAAGCAGG + Intergenic
1127961047 15:63891264-63891286 CACTGTGTCCACAGGCTGGGTGG + Intergenic
1132658908 16:1052982-1053004 CACAGTGTCCCCAGCGTGGCAGG - Intergenic
1133303266 16:4795737-4795759 GGCTGTGTCCACAGAGGAGCTGG + Exonic
1134043371 16:11084402-11084424 CCCAGGGCCCACAGTGTAGCAGG + Intronic
1134093389 16:11403347-11403369 CACGGTGTTGACAGTGTTGCAGG - Intronic
1139197507 16:64937851-64937873 CACTGTGTTAACAGTGTAATAGG - Intergenic
1139995789 16:70978811-70978833 CACTGTGTGCACAGTGTGTGGGG - Intronic
1140141237 16:72259901-72259923 GACTATGTCCTCAGTGCAGCTGG - Intergenic
1140342163 16:74175019-74175041 CACTGTGCCCAAAGATTAGCAGG + Intergenic
1141742499 16:85903206-85903228 CACTGTGCCCACAGTGGGGAAGG - Intronic
1142201881 16:88765025-88765047 CACTGTGTCCTCAGCGGTGCTGG + Intronic
1143982326 17:10880594-10880616 CACTATGTCTATAGTGTAGAAGG + Intergenic
1144779465 17:17800562-17800584 CACTGTCTCCTCAGTCCAGCAGG - Intronic
1147424015 17:40337134-40337156 CACTGTGTCCTCTGTGTAAGTGG - Intronic
1147892139 17:43724880-43724902 GACTGTGTCCACTGTTTATCTGG - Intergenic
1148733742 17:49852832-49852854 CTCTAGGTCCACAGTGTAGATGG + Intergenic
1151237824 17:72734364-72734386 CACTATGTCCACAGAGTACTGGG - Intronic
1153625190 18:7016550-7016572 CACTGTGTCCCAGGTGTGGCAGG - Exonic
1157251158 18:46097545-46097567 CACTGTGACAACAGTGAAGCTGG - Intronic
1163040631 19:14599591-14599613 CACTGTGTCCACATTCCAGTGGG - Intronic
1165439531 19:35816728-35816750 CATGGTGTTCACAGTCTAGCAGG - Intergenic
1165668644 19:37655687-37655709 CGCAGTGTCCACAGGGGAGCAGG - Intronic
1165713740 19:38030445-38030467 CACTTTAGCCCCAGTGTAGCTGG - Intronic
1165936725 19:39393759-39393781 CCCTGTGTCCTCAGTGTTGGTGG - Intronic
1166324680 19:42041992-42042014 CACTGTGAGCACAGTGGATCTGG - Intronic
1166525665 19:43508034-43508056 CACAGTGTCCACCGTGGAGGAGG - Exonic
1167750032 19:51373790-51373812 CACTGTCTTCACAGAGTGGCAGG - Intergenic
925192369 2:1894847-1894869 TGCTGTGAGCACAGTGTAGCAGG - Intronic
927075607 2:19573996-19574018 CACTGTGACCACAGAGGAGAGGG + Intergenic
927443069 2:23133398-23133420 TGCTGTTTACACAGTGTAGCTGG - Intergenic
927638498 2:24832435-24832457 GAGTGTGTCCACTGTGAAGCTGG - Intronic
932638932 2:73421859-73421881 CACTTTGTACACAGTGTTGCAGG + Intronic
935069132 2:99678014-99678036 TTCTGTGTCCACTGTGTGGCAGG + Intronic
935171661 2:100614960-100614982 CAATGTGCCCTCAGTGGAGCAGG + Intergenic
935688365 2:105707177-105707199 CCCAGTGTCCACAGTTTAGCAGG + Intergenic
936983831 2:118289423-118289445 CACTGAGTGCTCAGTGTAACAGG + Intergenic
938063892 2:128270899-128270921 CACGCTGTGCACAGTGCAGCAGG + Intronic
946077074 2:217083245-217083267 CAATGTGTCCCCAATGTATCAGG + Intergenic
947934899 2:233996322-233996344 GACGGTGCCCACCGTGTAGCTGG - Exonic
949026522 2:241768898-241768920 CACTGGGGCCATAGTGTGGCCGG + Intergenic
1168836604 20:881804-881826 CACTCTGTCCAGAGTGTGGAGGG + Intronic
1169760045 20:9081429-9081451 CACAGTGTCCACAGTGCAGCAGG - Intronic
1170668794 20:18410749-18410771 CACTGTGTTGCCAGTGTTGCCGG - Intronic
1172094760 20:32455196-32455218 CACTGTGGCCACAGGGTACATGG - Intronic
1173456909 20:43210088-43210110 CACTGTGGCCAAAGTACAGCAGG + Intergenic
1174339961 20:49889360-49889382 CACTGTGTCCCCAGAGAAGCAGG - Exonic
1175178475 20:57128177-57128199 CACTGCCTCCACTGTGTGGCTGG - Intergenic
1179730776 21:43366131-43366153 CTCTGTCTCCACAGTTTAGGCGG - Intergenic
1180833231 22:18916907-18916929 CACTGTGTCCTCATTGTGGGAGG + Exonic
1180938928 22:19644308-19644330 CCCTGTGTCCCCAGTGTGGCTGG + Intergenic
1181066594 22:20309349-20309371 CACTGTGTCCTCATTGTGGGAGG - Intergenic
1181402830 22:22661650-22661672 GGCTTTGTCCACAGTGTTGCCGG - Intergenic
1184279674 22:43429842-43429864 CACGGAGGCCACAGTGCAGCTGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
1185410048 22:50677136-50677158 GACTGTGTAGACAGTGAAGCTGG + Intergenic
1203283316 22_KI270734v1_random:142211-142233 CACTGTGTCCTCATTGTGGGAGG + Intergenic
950459114 3:13110700-13110722 CCCTGTGTCCCCAAGGTAGCAGG - Intergenic
951590171 3:24255887-24255909 CACTGTATCCACTGTGTTGAGGG + Intronic
957020346 3:75119448-75119470 TCCTTTGTCCACAGTGTATCAGG + Intergenic
961424982 3:126838006-126838028 CACCATGTCCACAGTGCAGATGG + Intronic
962938204 3:140101035-140101057 CAGTGTGACCCCAGTGTACCAGG - Intronic
966462770 3:180196005-180196027 TACTGTCTCCATAATGTAGCTGG - Intergenic
967968448 3:194982350-194982372 CACTGTGCACACAGTTTATCAGG - Intergenic
969014372 4:4093858-4093880 CACAGTGACCACAGTCTAGAAGG + Intergenic
969500852 4:7552129-7552151 CATTTTGTTCAAAGTGTAGCAGG - Intronic
970300294 4:14674016-14674038 CACAGTGTCCACAGTGCAGGAGG - Intergenic
971299983 4:25434001-25434023 CAATGTGTCCACATTCAAGCTGG - Intergenic
972583507 4:40416029-40416051 CACTGTGGCCCCAGTGTGGAAGG + Intergenic
974994520 4:69138071-69138093 CACTGAGTCCACAGTTTCACTGG + Intronic
975013916 4:69387313-69387335 CATTGTGTCAACAGTGAGGCAGG - Intronic
977588523 4:98801627-98801649 CACAGTGTGCACAGAGTGGCTGG - Intergenic
977656732 4:99530915-99530937 CAAAGTGGCCAGAGTGTAGCAGG - Intronic
979408226 4:120341070-120341092 CAGTGACTCCACAGTGAAGCAGG + Intergenic
980652078 4:135730516-135730538 TGCTGTCTCCACAGAGTAGCCGG - Intergenic
981349721 4:143715495-143715517 CACTGTGTACACAGGGTTTCTGG + Intergenic
982033051 4:151320080-151320102 CACTGTGTTCACGGTGTACCAGG - Intronic
983626818 4:169809938-169809960 CACAGTGTCCACAGTCTAGCGGG - Intergenic
986443549 5:7801397-7801419 CACTGCGTCCACAGTGGCCCCGG + Intronic
988698516 5:33648845-33648867 CATTGGGTCCATATTGTAGCTGG + Exonic
992200436 5:74378631-74378653 CAGTGTTTCCCAAGTGTAGCTGG + Intergenic
993997532 5:94740720-94740742 AACTGTGTGCAGAGTATAGCAGG + Intronic
994569556 5:101498017-101498039 CAATAATTCCACAGTGTAGCAGG - Intergenic
995338138 5:111026081-111026103 CACTGTGTCCTCATGGTAGAAGG - Intergenic
997696133 5:135862541-135862563 CAGGGTGTCCACAGTCTAGTGGG + Intronic
998649156 5:144098393-144098415 CACTGTGTACACATAGTAGGTGG + Intergenic
1000663357 5:163963729-163963751 CAATGTCTCCAGAGTTTAGCAGG + Intergenic
1002719949 5:181252755-181252777 CACTGAGTCCACAGTGGAGGTGG - Intergenic
1005910224 6:30303020-30303042 CACTGTCCCCACAGAGTGGCTGG + Intergenic
1012388447 6:98708763-98708785 CTGTGTTTCCACATTGTAGCTGG - Intergenic
1015125262 6:129747348-129747370 CACTGTGTCCAGCTTGGAGCTGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017788143 6:157773302-157773324 CACTGTGTCCACAGTGTAGCTGG - Intronic
1019574605 7:1730557-1730579 CACAGTGTCCACAGGTCAGCTGG + Intronic
1021706344 7:23371910-23371932 CACTGTGACTTCAGTGTGGCTGG - Intronic
1022018981 7:26380283-26380305 CAATGTGTCCAAAATGTAACTGG - Intergenic
1022592054 7:31672979-31673001 CACTTTGTTCACAGGGAAGCAGG - Intergenic
1023911831 7:44561877-44561899 CACTGTGCCCACAGAGCACCTGG + Intergenic
1028213081 7:88099396-88099418 CACTGTGTGCTCAGGTTAGCCGG - Intronic
1028577734 7:92370783-92370805 CACTGTGCCAGCAGTGTAGTTGG + Intronic
1029929870 7:104359650-104359672 TTCTGTGTCCACAGTCTAGCGGG + Intronic
1035055232 7:156030875-156030897 CCCTGTGCACACAGTGTGGCTGG + Intergenic
1038665805 8:29536861-29536883 CACTGAGACCAAATTGTAGCAGG + Intergenic
1043803099 8:84636546-84636568 CACTGTGTCCTCCATCTAGCTGG + Intronic
1047995757 8:130333925-130333947 CACAGTGTGCACAGAGCAGCTGG + Intronic
1049818364 8:144619025-144619047 CCCTGTGTCCACTGTGGACCAGG - Intergenic
1051355463 9:16236007-16236029 CTCTCTGGCCACAGTGTGGCTGG - Intronic
1055742110 9:79401514-79401536 CACCTTGTCCAGAGTCTAGCTGG + Intergenic
1055909058 9:81326727-81326749 CACTGTGTCAACTGTGATGCTGG + Intergenic
1056001723 9:82224685-82224707 CTCTGTGTCCACACAGAAGCAGG + Intergenic
1056809793 9:89755339-89755361 AATTGTGTTCACAGTGTAGGTGG + Intergenic
1061726964 9:132587315-132587337 CGCTGTGTCCGCAGTGAAGGAGG + Exonic
1061751152 9:132777896-132777918 CATTGTTTCCACAGTGTCGGTGG - Intronic
1062270879 9:135707762-135707784 CCCTGTGTCCACTGTGCTGCTGG + Intronic
1189563955 X:42220146-42220168 CACTGTTTCCACCCTTTAGCTGG + Intergenic
1189701991 X:43721297-43721319 AACTGAGTGGACAGTGTAGCTGG + Intronic
1192042194 X:67634358-67634380 CACTGTGTCCGCAGTGGTGTGGG + Intronic
1196162068 X:112496251-112496273 CACTGTGTCCACAAGGTATGAGG + Intergenic
1197063064 X:122205064-122205086 TACTGTTTCCACATTGAAGCTGG - Intergenic
1201405489 Y:13645619-13645641 TACTGTGTCCACAGAGGAGGAGG + Intergenic