ID: 1017793897

View in Genome Browser
Species Human (GRCh38)
Location 6:157823871-157823893
Sequence GACCCTCGCCCCCGCGGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017793875_1017793897 15 Left 1017793875 6:157823833-157823855 CCCGCCGCCCCCACGTCCCCTCC 0: 1
1: 0
2: 12
3: 102
4: 1063
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793877_1017793897 11 Left 1017793877 6:157823837-157823859 CCGCCCCCACGTCCCCTCCCGCT 0: 1
1: 0
2: 3
3: 111
4: 1172
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793873_1017793897 23 Left 1017793873 6:157823825-157823847 CCGGCGTCCCCGCCGCCCCCACG 0: 1
1: 0
2: 8
3: 80
4: 745
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793878_1017793897 8 Left 1017793878 6:157823840-157823862 CCCCCACGTCCCCTCCCGCTGCC 0: 1
1: 1
2: 2
3: 109
4: 965
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793889_1017793897 -6 Left 1017793889 6:157823854-157823876 CCCGCTGCCGCCTGGGGGACCCT 0: 1
1: 0
2: 3
3: 22
4: 257
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793888_1017793897 -3 Left 1017793888 6:157823851-157823873 CCTCCCGCTGCCGCCTGGGGGAC 0: 1
1: 0
2: 0
3: 37
4: 256
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793885_1017793897 -1 Left 1017793885 6:157823849-157823871 CCCCTCCCGCTGCCGCCTGGGGG 0: 1
1: 0
2: 4
3: 36
4: 349
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793874_1017793897 16 Left 1017793874 6:157823832-157823854 CCCCGCCGCCCCCACGTCCCCTC 0: 1
1: 0
2: 5
3: 94
4: 819
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793887_1017793897 -2 Left 1017793887 6:157823850-157823872 CCCTCCCGCTGCCGCCTGGGGGA 0: 1
1: 0
2: 1
3: 32
4: 479
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793879_1017793897 7 Left 1017793879 6:157823841-157823863 CCCCACGTCCCCTCCCGCTGCCG 0: 1
1: 0
2: 2
3: 19
4: 345
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793876_1017793897 14 Left 1017793876 6:157823834-157823856 CCGCCGCCCCCACGTCCCCTCCC 0: 1
1: 2
2: 18
3: 270
4: 2499
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793881_1017793897 5 Left 1017793881 6:157823843-157823865 CCACGTCCCCTCCCGCTGCCGCC 0: 1
1: 0
2: 6
3: 96
4: 941
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793880_1017793897 6 Left 1017793880 6:157823842-157823864 CCCACGTCCCCTCCCGCTGCCGC 0: 1
1: 0
2: 3
3: 26
4: 345
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145
1017793890_1017793897 -7 Left 1017793890 6:157823855-157823877 CCGCTGCCGCCTGGGGGACCCTC 0: 1
1: 0
2: 2
3: 30
4: 289
Right 1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG 0: 1
1: 0
2: 0
3: 13
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017793897 Original CRISPR GACCCTCGCCCCCGCGGGGC GGG Intronic
900113550 1:1019604-1019626 GCGCCCCTCCCCCGCGGGGCCGG - Intergenic
900117266 1:1034003-1034025 TCCCCTCGTCCCCGCGGGGCTGG - Intronic
900228009 1:1541623-1541645 GACCCTCGCCCCTGAGGAGGTGG - Intergenic
900283911 1:1890494-1890516 GACCCGCGCCCCCGGGGCCCCGG + Intronic
900326079 1:2109316-2109338 GACCATCGCCCCTGCGCGTCCGG - Intronic
900488490 1:2934818-2934840 GACCCCCTCTCCCGCAGGGCTGG - Intergenic
900494836 1:2971723-2971745 GACACTGGCCCCCTGGGGGCTGG + Intergenic
900589870 1:3454790-3454812 GTCCCTCCGCCCCGCGGCGCAGG + Exonic
901022715 1:6263115-6263137 GCCCCTTGGCCCCCCGGGGCTGG - Intergenic
901818106 1:11806328-11806350 GACCCGCACCCCCGAGGAGCTGG + Exonic
902514054 1:16980507-16980529 CACCCTCGCCCCCGCGCCGGGGG + Intronic
903724680 1:25431440-25431462 GCCCCTCCCCCCGGCGGGCCCGG - Intronic
903738281 1:25543922-25543944 GACCCCCTGCCCCGCAGGGCCGG - Intronic
903967256 1:27098615-27098637 GCCGCTCTCCCCCGCGGGGCAGG + Intergenic
904050461 1:27635163-27635185 GACCGCCGCCCCTGCTGGGCAGG + Exonic
907450412 1:54542452-54542474 GCCCTTCCCCCGCGCGGGGCGGG - Intronic
911116110 1:94247804-94247826 GGCCCGCGCTCCCGGGGGGCGGG + Intronic
914428620 1:147600249-147600271 GGCTCTCAGCCCCGCGGGGCCGG - Intronic
915135402 1:153728142-153728164 CACCCTCACCCCCTAGGGGCCGG + Exonic
915616867 1:157045865-157045887 TTCCCTCGCTCCCGCGGGGCGGG + Intergenic
919640391 1:200039870-200039892 CTCCCGCGCCCGCGCGGGGCGGG - Intronic
1062973566 10:1666299-1666321 GATGCTCGCCCTGGCGGGGCAGG - Intronic
1067812670 10:49442051-49442073 GACCCGCGCCCCCGGGGGAAGGG + Intergenic
1068560957 10:58513451-58513473 GGCCCGCTCCCCCGCGGAGCCGG + Intronic
1072834511 10:98696578-98696600 GACCCTCGCCCCAGTGGTGTGGG - Intronic
1074137952 10:110644237-110644259 GGCCCCCGCCCCCGCGTGGCCGG + Intergenic
1074864554 10:117537258-117537280 GATCCGCGCCCCCTCGCGGCTGG - Intergenic
1083751866 11:64765493-64765515 GGCCATCGCCGCCGCGGGGAGGG + Exonic
1087762086 11:102111578-102111600 CACCTTCGCTCCCGCCGGGCCGG + Intronic
1089046103 11:115503557-115503579 GGCCGCCCCCCCCGCGGGGCCGG + Intronic
1091219361 11:133920907-133920929 GGCCCTCCAGCCCGCGGGGCTGG + Exonic
1096494845 12:52033933-52033955 TACCCCCGCCCCCGAGGGCCAGG + Intronic
1103724697 12:122991826-122991848 GCCCCTCTCCCCCACGGGGACGG - Intronic
1103949332 12:124542616-124542638 GACCCTGGCCCCCAAGGGGCAGG + Intronic
1106602568 13:31200259-31200281 GACGCGCGCGCCGGCGGGGCAGG - Intronic
1117315314 14:54566673-54566695 GAGCCTCGCCCGCGCGTCGCAGG - Intergenic
1121168826 14:91836324-91836346 GTCCCACGCCCGCGCTGGGCCGG + Intronic
1124453849 15:29822501-29822523 CAGCCCCGCCCCCGCCGGGCCGG - Exonic
1125652938 15:41332396-41332418 GCCGCTCGGCCCCGCAGGGCTGG - Exonic
1125742000 15:41972077-41972099 GACCCTCCAGCGCGCGGGGCTGG + Intronic
1127426634 15:58864962-58864984 CACCCTGGGCCACGCGGGGCAGG + Intergenic
1129221519 15:74134282-74134304 GGCCCTGGGCCCGGCGGGGCTGG + Exonic
1132314559 15:100880242-100880264 GTCCAGCGCCCGCGCGGGGCCGG + Intronic
1132642023 16:982352-982374 GAACCCCGCCCCCGGGGCGCCGG - Intronic
1132930321 16:2455698-2455720 GACACACTCCCCGGCGGGGCAGG - Intronic
1132932998 16:2468210-2468232 CAACCTCGCCCCGGCCGGGCGGG + Intergenic
1133271891 16:4614440-4614462 GACTCGCGGCCCCGCGGGGGCGG + Intronic
1133760963 16:8797927-8797949 GACCCTCACCGCCCCGCGGCAGG + Exonic
1136381973 16:29900104-29900126 TCCCCTCGCCCCGCCGGGGCGGG + Intergenic
1138553084 16:57757733-57757755 GACCCTGACCACCCCGGGGCGGG - Intergenic
1138611612 16:58129433-58129455 GCCCCGCGCTCCCGGGGGGCGGG - Exonic
1141670829 16:85490972-85490994 GAGCCTCCCCAACGCGGGGCTGG + Intergenic
1142376873 16:89711139-89711161 GCCCCCCGCCCCCGCTGGGGAGG + Intronic
1142393086 16:89815746-89815768 GACCCTCCCCTCTGCGGGCCAGG + Intronic
1143447975 17:7019915-7019937 GACCCTAGCCCCCGAGCGGTGGG - Intergenic
1143625794 17:8109650-8109672 GACCCGTGGCCCGGCGGGGCTGG + Intronic
1144390881 17:14792248-14792270 GGCCCTCACCCCGTCGGGGCTGG + Intergenic
1144787494 17:17840180-17840202 CAGCCCCGCCCCCGCGGGCCCGG + Intergenic
1149430824 17:56594481-56594503 CACCCCCGCCCCCGCCGGGCCGG - Exonic
1150060613 17:62065429-62065451 GGCCCTCGGCCCCGGGCGGCTGG - Intergenic
1150484869 17:65536832-65536854 GACCCTCGCGGCCGCGGCGGCGG + Intronic
1151559148 17:74861497-74861519 GAGCCTCGGCCCCGGAGGGCTGG + Intronic
1151783831 17:76265630-76265652 GAGCCTGGCCGCCGCGGGGCCGG + Intronic
1152140002 17:78530623-78530645 GACCCTGGCCCCAGAGTGGCCGG - Intronic
1152938454 17:83153719-83153741 CTCCCTCCCCCCAGCGGGGCAGG - Intergenic
1154125695 18:11689985-11690007 GCCCGCCGCCCCCGCGGGCCCGG - Intronic
1154961692 18:21315941-21315963 GACCCTCCCCCCTGTGGGCCTGG + Intronic
1160904578 19:1446235-1446257 CACCCTGGCCGCCGAGGGGCGGG + Intergenic
1161450595 19:4343513-4343535 GCCCCTCCCCTCCCCGGGGCGGG + Exonic
1161521423 19:4725920-4725942 CACCCTCACTCCTGCGGGGCTGG + Intergenic
1161550645 19:4910298-4910320 TACCATGGCCACCGCGGGGCGGG + Intronic
1161628369 19:5339643-5339665 AACCCTCGCACCCACGGCGCGGG + Intronic
1161850807 19:6737223-6737245 GAGCCTCGCCCCCGAAGGGAGGG + Intronic
1161990305 19:7680932-7680954 GACCCACACGCCCGCGGGGAAGG - Intronic
1162901024 19:13795626-13795648 GGCCCTGGCCCCGGCCGGGCCGG + Exonic
1163596947 19:18225924-18225946 GACCCTCGCCGGCCTGGGGCAGG - Intronic
1163666692 19:18606865-18606887 GCCCGCCGCCCCCCCGGGGCCGG - Intronic
1164207473 19:23070734-23070756 GACCATCCCACCCGCGGGGTGGG + Intergenic
1164617803 19:29677183-29677205 GTCCCTCTCCCCTGCAGGGCTGG + Intergenic
1164834956 19:31350414-31350436 GCCCCTCGCCCCCGGGAGCCGGG + Intergenic
1165994284 19:39833393-39833415 TGCCCTCCCCGCCGCGGGGCCGG - Exonic
1167037753 19:47004090-47004112 GACCCAGCCCCCCGCGCGGCAGG - Exonic
1167703436 19:51064897-51064919 GCCCCCCGCCCACTCGGGGCCGG - Intronic
1167793917 19:51696898-51696920 GACCCTGGGGCCCGTGGGGCTGG + Intergenic
1168121323 19:54254030-54254052 GCCCCTCACCCCCACGGGGTTGG - Exonic
925730727 2:6917948-6917970 GACCCGCGACCGCGCAGGGCAGG - Intronic
926914392 2:17878634-17878656 GAGCCTCGCTCTAGCGGGGCGGG + Intronic
927713933 2:25341181-25341203 CCTCCTCGGCCCCGCGGGGCGGG - Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
929775779 2:44929699-44929721 GTCCCTCGCGCCTTCGGGGCCGG - Intergenic
930011450 2:46941145-46941167 TCCCCACGCCCCCGCGGGGGTGG + Intronic
930136334 2:47906504-47906526 GTCCCTCCCCGCCGCGGGGCTGG + Intergenic
932702793 2:74002667-74002689 TCCCCTCCCCGCCGCGGGGCTGG - Intronic
932773672 2:74514914-74514936 GACCCTGGCCCCCGCGACCCAGG - Exonic
934579536 2:95427340-95427362 GCCCCTCCGCCCCGCAGGGCTGG - Intergenic
934599908 2:95649385-95649407 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
935971505 2:108534410-108534432 CTCCCGCGCCCCCGCGCGGCCGG + Intronic
936533251 2:113291389-113291411 GCCCCTCCGCCCCGCAGGGCTGG + Intergenic
948479060 2:238239321-238239343 GAGCCGCGTCCCCGCGGGCCGGG - Intronic
1174507171 20:51024004-51024026 GGGCCTCGGCCCCGCGGGACTGG - Intergenic
1175399667 20:58693135-58693157 CACCCCCGCCGCCGCCGGGCCGG + Intronic
1176015028 20:62926518-62926540 GAGCGGCGCCCCCGCGCGGCGGG + Intronic
1176092571 20:63325626-63325648 GACCCTGGCCCCTGCCTGGCCGG + Intronic
1178327893 21:31660053-31660075 GACCGAGGCCGCCGCGGGGCTGG + Intronic
1179209563 21:39313634-39313656 GACCGACGCCTCCGCGGGGGAGG + Exonic
1179913581 21:44462611-44462633 GACCCTCGCCCCAGCCTGGGAGG - Intergenic
1181150997 22:20883470-20883492 GACCCTGTCCCCAGAGGGGCTGG + Exonic
1184645661 22:45893310-45893332 GACCCTGGCCTCCTAGGGGCTGG + Intergenic
949260430 3:2098595-2098617 GCCTCTCGGCCGCGCGGGGCAGG + Intergenic
950273985 3:11642919-11642941 GTCCCTCTCCCGCGTGGGGCCGG - Intronic
950940194 3:16884438-16884460 GCCCCCCGCCCGCCCGGGGCCGG + Intronic
959849824 3:111072388-111072410 GACCCGCGCGGCCGCGGGGGAGG - Intronic
961013218 3:123449194-123449216 GACCCTCCCCCCCGGGGCTCCGG - Exonic
962746370 3:138400056-138400078 GACCCTGGCCCCGTCGGAGCTGG - Intronic
963081847 3:141402242-141402264 GACCCGCAGCCCCGCGGGCCCGG - Intronic
966886579 3:184380524-184380546 GCCCCGCGCCCCCTCCGGGCTGG - Intronic
968225179 3:196968727-196968749 GACCCTGGCCCTCGCCGGGCAGG - Exonic
969517173 4:7654313-7654335 GACCCTCCCCATCCCGGGGCTGG + Intronic
971257966 4:25031008-25031030 GGCCCCCTCCCCCGCGGGGCGGG - Intergenic
974549056 4:63348994-63349016 GGCCCTCGGCCGGGCGGGGCCGG + Intergenic
982209585 4:153023567-153023589 GACCCTGGGCCCCTCAGGGCTGG + Intergenic
984916996 4:184733981-184734003 GACCCTCGGGAGCGCGGGGCCGG - Intronic
989379393 5:40798333-40798355 GACGCTCCCCCTGGCGGGGCGGG + Exonic
994171402 5:96662602-96662624 CCCCGGCGCCCCCGCGGGGCAGG + Intronic
1001328369 5:170745522-170745544 GACCCTCGCCCACGCCCAGCAGG + Intergenic
1001563334 5:172684147-172684169 GGGCCTCGCGCACGCGGGGCCGG - Intronic
1004442064 6:15663044-15663066 GAGCCTGGCGCGCGCGGGGCGGG - Intronic
1005851728 6:29827968-29827990 GTCCTGCGCCCCCGCCGGGCCGG - Intronic
1005859104 6:29887875-29887897 GTCCTGCGCCCCCGCCGGGCGGG - Intergenic
1005931695 6:30489646-30489668 GTCCTTCGCCCCCGCCGGGCCGG - Intronic
1006137117 6:31901957-31901979 GACGCGCGCGCGCGCGGGGCCGG + Exonic
1006706935 6:36028313-36028335 GCCCCTCGCGCCCGAGGGCCAGG + Intronic
1006779758 6:36624340-36624362 GACCCTGGGCCCAGCGGTGCCGG + Intergenic
1006911400 6:37565936-37565958 GCCCCTCACCCCAGCTGGGCTGG + Intergenic
1013836531 6:114342155-114342177 GCCCCTCCCCCGCGCGAGGCGGG + Intronic
1014255505 6:119157082-119157104 GACCCTCAGCCCCAAGGGGCTGG - Intergenic
1015513444 6:134061591-134061613 GACCTTCCCTCCCCCGGGGCTGG + Intergenic
1017793897 6:157823871-157823893 GACCCTCGCCCCCGCGGGGCGGG + Intronic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1024930681 7:54664454-54664476 GACCCTCGCGGCCGCGCGCCCGG - Intergenic
1028622236 7:92836785-92836807 GACCCACCCCCCGGCGGGGCTGG + Intergenic
1030597990 7:111562317-111562339 GGCCCCGGCCCCGGCGGGGCGGG - Intronic
1035202470 7:157276317-157276339 GGCCCTGGCCACTGCGGGGCAGG + Intergenic
1041464561 8:58145797-58145819 GACCCTCGGCCGCGCAGGGGCGG + Intronic
1042591960 8:70404406-70404428 GACCCTCGCGCCCGTCCGGCCGG + Intergenic
1047961685 8:130016152-130016174 GACCCCCGCGCCCGCCGGCCCGG + Intronic
1049446091 8:142632314-142632336 GCCCCTTGCCCACACGGGGCAGG - Intergenic
1051876911 9:21802884-21802906 GTCCCTTGCCGCCGCGGGGAGGG + Intronic
1052821335 9:33139855-33139877 GGCTCTCGGCCCCGCTGGGCTGG + Intronic
1057773239 9:97984704-97984726 GAGCCAAGCCCCGGCGGGGCGGG - Intronic
1060261878 9:122082909-122082931 AACCCTCGCCCCCCAGGAGCTGG - Intronic
1060412135 9:123406820-123406842 GCCCCGGGGCCCCGCGGGGCAGG - Intronic
1060599516 9:124868893-124868915 GCCCCTGGCCTCAGCGGGGCCGG - Exonic
1061037661 9:128122522-128122544 GACCCTCTTCCCTGCTGGGCTGG - Intronic
1061073008 9:128323160-128323182 GCGCCTCGCCCCCGTGGGGGCGG + Intronic
1061208281 9:129176796-129176818 GACCCGGGGCCCCGCGGGGCTGG - Exonic
1061541070 9:131278016-131278038 GACCTGCATCCCCGCGGGGCCGG - Intergenic
1198683543 X:139205224-139205246 TACCCTGGCCCCTCCGGGGCAGG + Intronic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic