ID: 1017795333

View in Genome Browser
Species Human (GRCh38)
Location 6:157839401-157839423
Sequence GCATATGTATTTTCATGTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 286}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017795333 Original CRISPR GCATATGTATTTTCATGTAA TGG Intronic
900561815 1:3310750-3310772 GAATATGTGTTTGCATGTATGGG + Intronic
901441022 1:9278583-9278605 GCATTTGGCTTTTCTTGTAAGGG + Intergenic
902541799 1:17161005-17161027 GCATGTGTATTTGAATGTACAGG - Intergenic
904151072 1:28441476-28441498 GCATATGAATCCTCATGCAAAGG - Intronic
905051963 1:35059559-35059581 GAATATGTATTTGCATGCAAGGG + Intergenic
905055394 1:35089301-35089323 GCATGTGTACTTTCAGGTGAAGG + Intronic
905934208 1:41810879-41810901 GCTTATGGATTTGCCTGTAATGG + Intronic
906464662 1:46066437-46066459 ACATAAGTATTTTTATATAAAGG + Intronic
906941105 1:50256261-50256283 GCATATGTATCTCCATGTCAAGG - Intergenic
907533883 1:55130005-55130027 GCATATGTATTTTACTTTATAGG + Intronic
909672129 1:78201444-78201466 TAAGATGTATTTGCATGTAATGG - Intergenic
910050687 1:82970533-82970555 ATATATGTATTTTCATGTGAGGG + Intergenic
910251641 1:85203555-85203577 GTTTATGAATTTTCTTGTAAAGG - Intergenic
912092503 1:106097844-106097866 GAATATGTCTTTGCATGTATAGG + Intergenic
914371508 1:147029259-147029281 GAAGATGTATTTTCAAGGAAAGG + Intergenic
915892410 1:159784035-159784057 GTGTGTGTATTTTCATGTGAAGG + Intergenic
916417259 1:164603494-164603516 GGATCTGTATTTTCACATAATGG - Intronic
916494432 1:165332830-165332852 GCATTTAAATTTTCATGGAAAGG + Intronic
917217731 1:172695453-172695475 GCAGATGTATTTTTATATAAAGG + Intergenic
917924776 1:179780173-179780195 GCAAATGTATATTTATGTTATGG + Intronic
919015254 1:192025200-192025222 GCATATGTATGTTCATTGCAGGG - Intergenic
919061841 1:192643442-192643464 TGATATGTATTGTTATGTAAAGG + Intronic
919300181 1:195752431-195752453 ACATGTGAATTTTCATGTCAAGG + Intergenic
921028944 1:211319631-211319653 TCAATTGTATTTTCATATAATGG + Intergenic
921968759 1:221121553-221121575 TCATATGTAATTTCAAGGAATGG + Intergenic
1065106884 10:22397619-22397641 TCAATTGTATTTTCATGTACAGG + Intronic
1066490748 10:35892132-35892154 GAATATTTATTTGCATTTAAAGG + Intergenic
1067465008 10:46491256-46491278 GCACAAGTATCTTCATTTAATGG - Intergenic
1067622180 10:47893345-47893367 GCACAAGTATCTTCATTTAATGG + Intergenic
1071872146 10:89807669-89807691 GCAGATGTAATTTGATGTCATGG + Intergenic
1072085170 10:92072162-92072184 GGGTATGTTTTTTCATTTAAAGG - Intronic
1072325412 10:94293479-94293501 GCTTATTTATTTTCATTTTATGG + Intronic
1072354130 10:94589393-94589415 GCATTTGTATTTTCCCGTTAGGG + Intronic
1073165341 10:101443438-101443460 ACATATGTATTTTTCTGTTAAGG - Intronic
1078376805 11:10802203-10802225 GTATATGTATTTTAAGGTAGCGG - Exonic
1078775237 11:14387908-14387930 GCATTTGTGTTTTCTTCTAAGGG + Intergenic
1079508858 11:21186280-21186302 GCATATGCAGTTCCCTGTAAGGG + Intronic
1081226681 11:40532584-40532606 GGATATCTAGTGTCATGTAAGGG + Intronic
1083118388 11:60486906-60486928 GTATTTATATTTTCATGAAATGG - Intergenic
1083487453 11:62992616-62992638 ACACATGTATTTTCATGCACAGG + Intronic
1086240064 11:84679518-84679540 GAATATGGATTTTCATGTGAAGG + Intronic
1086794216 11:91080700-91080722 GCAGATGGAGTTTCATGTAAAGG + Intergenic
1086944998 11:92836169-92836191 GCCTATGCATTTCCATGTTAAGG - Intronic
1088205918 11:107392070-107392092 GGATATGTCTTCTAATGTAATGG - Intronic
1088559543 11:111098719-111098741 GCACATGTTTTTGCATGTAAAGG + Intergenic
1089891089 11:121881708-121881730 GCTTAAGTATTTTCAAGAAAGGG + Intergenic
1091093609 11:132795641-132795663 CCATATTTAATTTCATGTAAAGG + Intronic
1091920012 12:4296459-4296481 GCATTTCTTTTTTAATGTAATGG + Intronic
1092631839 12:10388059-10388081 ACATATGTAAATTCATGTCACGG + Intronic
1093100378 12:15021057-15021079 AAATATTTATTTTCAGGTAATGG + Intergenic
1094457801 12:30658193-30658215 GCATATGCATTTTTGTTTAATGG - Intronic
1094734314 12:33216755-33216777 GCATATGAAAAATCATGTAATGG + Intergenic
1094779963 12:33779398-33779420 GCAGATTTATTTTCCTGTATGGG + Intergenic
1096949032 12:55445266-55445288 AAGTATGTATTTTCCTGTAATGG + Intergenic
1097785532 12:63754800-63754822 ACATTTGTTCTTTCATGTAAAGG - Intergenic
1098343444 12:69475024-69475046 TCATATGTGTTATCATATAATGG - Intronic
1098388912 12:69948687-69948709 GCATATGTGTTTACTTGTAAAGG + Intronic
1098400312 12:70068007-70068029 GCATATGTATTTTCATATCGCGG + Intergenic
1098908153 12:76182252-76182274 GCATAAGTTTTCTCATTTAAAGG + Intergenic
1099727604 12:86453111-86453133 GCATATTCATTCTCATTTAAAGG - Intronic
1100054920 12:90497473-90497495 GAAAATGAATTTTCATCTAAAGG + Intergenic
1100683761 12:96961740-96961762 GCATATGTTTTTTCACTTTATGG - Intergenic
1101052826 12:100881349-100881371 GCATTTGTATTATAATATAAAGG - Intronic
1104048021 12:125177114-125177136 GCACATGAATTTTCATGGCAGGG + Intergenic
1104261693 12:127189358-127189380 TCATATGTATTTACATTAAATGG + Intergenic
1105647063 13:22332372-22332394 GCATGTGTTTTTAAATGTAAGGG + Intergenic
1105797600 13:23871458-23871480 GCATATGAATTTTCAGTTACTGG + Intronic
1106183908 13:27391554-27391576 GCTGATGTATTTTCATGTTTTGG + Intergenic
1107689789 13:42941831-42941853 GAATATGTGTTTTCATATATTGG + Intronic
1107944346 13:45404510-45404532 GCATATGTTTTTACATCTTAAGG - Intronic
1108645746 13:52425835-52425857 GCATAACTATTTTCATGATATGG - Intronic
1108920642 13:55669609-55669631 ACAAATGTATTGTCATGTAAAGG + Intergenic
1108943207 13:55984321-55984343 GCATATATATTTTCAATGAATGG + Intergenic
1109294987 13:60519498-60519520 ATACATGTATTTTCATTTAATGG + Intronic
1109800923 13:67377684-67377706 GCACATGTATGTTCATGTTTGGG + Intergenic
1109953025 13:69526982-69527004 TCATATGTTTTCTCATATAAGGG + Intergenic
1110010099 13:70321817-70321839 GCATATATATTTTCTGGTACAGG + Intergenic
1110026415 13:70545875-70545897 CCATATGTATTTTTATTTGAGGG - Intergenic
1110858389 13:80321745-80321767 GCATATACATTTTCATTTGAAGG + Intergenic
1111394161 13:87643083-87643105 GAATAAGTATTTTCAGGTATTGG - Intergenic
1113181501 13:107633154-107633176 GCTTTTATATTTTCATATAAAGG + Intronic
1113474962 13:110574038-110574060 GCAAATGAATTTTCATTAAATGG + Intergenic
1114860558 14:26514785-26514807 TCATATGTATTTTTAATTAAAGG - Intronic
1115661148 14:35495260-35495282 GCAGCTGTAATTTCATGAAATGG - Intergenic
1115887159 14:37985368-37985390 ACATATGTATATTCATATTAAGG + Intronic
1116910849 14:50462144-50462166 GCATATTATTTTTCATGAAAAGG - Intronic
1117261162 14:54035000-54035022 ACATATGTTTTATTATGTAATGG + Intergenic
1117896788 14:60495616-60495638 TCATAGATATTTTCAGGTAAAGG - Intronic
1120062557 14:80001319-80001341 GTATATTTTTTATCATGTAATGG + Intergenic
1120257081 14:82134272-82134294 GTATATGGCTTTTCAAGTAAGGG + Intergenic
1121151195 14:91636749-91636771 GAAGATGTATTTTCCTGTTAAGG + Intronic
1121399461 14:93659907-93659929 GAATATGTTTTTTCATTAAATGG - Intronic
1121943354 14:98094219-98094241 GAGTAGGTATTTACATGTAAGGG + Intergenic
1123679324 15:22747060-22747082 ACATATATTTTTTCATGTTACGG - Intergenic
1125040737 15:35184482-35184504 CCATTTGAATTTTCATGAAATGG - Intergenic
1125400668 15:39299225-39299247 GCATATGTCTTTTCATTTTGAGG + Intergenic
1125568837 15:40698740-40698762 GCATTTGTATTTTTCAGTAATGG + Exonic
1126831819 15:52615064-52615086 GACTATGAATTTTCATGTCACGG - Intronic
1127413940 15:58738265-58738287 GAATATGTATTATCAAATAAAGG - Intronic
1127894315 15:63281501-63281523 CCATATGCATTTTCATGCCATGG + Intronic
1128524211 15:68401364-68401386 GCATATGTATTCACTTGTATTGG - Intronic
1128838386 15:70829799-70829821 TCATCTGTATTCACATGTAAAGG + Exonic
1129101531 15:73269206-73269228 GCATATCACTATTCATGTAAGGG - Intronic
1129984109 15:79901696-79901718 GTATATTTATTTTTATATAATGG - Intronic
1129991095 15:79964108-79964130 GTATATTTATTTTTATATAATGG - Intronic
1137058716 16:35763782-35763804 TCATATGTGTTTTCATCTCATGG - Intergenic
1138806223 16:60092424-60092446 GTACATGTATTTTTATGTGATGG - Intergenic
1140646036 16:77031071-77031093 TCAAATGTATTTTCTAGTAAGGG - Intergenic
1145283095 17:21482600-21482622 GCTTATGTATTTTTCTGCAAAGG + Intergenic
1149367407 17:55959677-55959699 CCATATGTGTTTTCAACTAAAGG - Intergenic
1150583760 17:66499013-66499035 GCATATGAATTTTCAGGACATGG + Intronic
1151525561 17:74664238-74664260 GCTTCTGTATTAACATGTAAAGG + Intergenic
1153354732 18:4122693-4122715 GTATTTGTATTTTCATTTCAAGG + Intronic
1153934222 18:9906426-9906448 GCATACGTATTTTCATATGTTGG - Intergenic
1154109939 18:11559030-11559052 ACATATGATTTTTCTTGTAATGG - Intergenic
1154481623 18:14832641-14832663 GCAAATGAATTTTTATGTAATGG + Intronic
1155390362 18:25329316-25329338 GCATATGTTATTTCATGACAAGG + Intronic
1156333565 18:36148557-36148579 GCCTATATTTTTTGATGTAAAGG - Intronic
1156419132 18:36931996-36932018 CCATATGTACTTACATTTAATGG + Intronic
1156848044 18:41692146-41692168 ACATAGGTCTTTTCATATAAAGG + Intergenic
1157649191 18:49310744-49310766 ATATATGTTTTTTAATGTAAAGG - Intronic
1160032668 18:75276661-75276683 GTAAATGTATTTTGATATAATGG + Intronic
1160610868 18:80084062-80084084 GCCTAGGGATTTTCAGGTAAAGG - Intronic
1164664381 19:30016254-30016276 GAATATGTATTTTAATGACAAGG + Exonic
1168429554 19:56267206-56267228 ACATATATAATTTCATGTACTGG - Intronic
925354102 2:3225048-3225070 GCATATCTATTTACATGTGTGGG + Intronic
926791751 2:16579358-16579380 GCATATGTATTTACTTGTTCTGG - Intronic
927280379 2:21299614-21299636 GCATATGTTTTTTTATGTTTTGG - Intergenic
927624172 2:24695891-24695913 GCATGTGTGTGTTCATGTCAGGG - Intronic
927859627 2:26552566-26552588 GGAAGTGTATTTTCATGTAATGG - Intronic
929252593 2:39775845-39775867 CCATAGTTATTTTCATTTAATGG - Intronic
933214245 2:79609329-79609351 GCATAAGTATATTCATCTTATGG + Intronic
935496256 2:103785113-103785135 GCATATGCATTTACCTGTTATGG - Intergenic
938367162 2:130743955-130743977 GAAAATGTAGTTGCATGTAAAGG + Intergenic
938682419 2:133705185-133705207 GCAAATGTATATTCATGTGCTGG - Intergenic
940710944 2:157162926-157162948 TCATATATATTTTTATTTAAAGG + Intergenic
941285368 2:163606030-163606052 GCCTATGTATTTTAGTGGAATGG + Exonic
941563301 2:167076769-167076791 GAAAATGTATTTTCATGTTAAGG + Intronic
942421224 2:175810040-175810062 GCAGATGTAATTTAATGTTAAGG - Intergenic
943469832 2:188280423-188280445 GTATATGTCATTTTATGTAATGG - Intergenic
943954464 2:194170523-194170545 TCATATCAATTTTAATGTAATGG + Intergenic
944158891 2:196638783-196638805 GAATATGTATTCTCACTTAAGGG - Intergenic
945747237 2:213733164-213733186 GAGTATGTCTGTTCATGTAAAGG + Intronic
945922851 2:215773547-215773569 GAATATATTTTTTCATGTATTGG - Intergenic
947476844 2:230457738-230457760 GCAAAGGTATTTTCATGCATAGG + Intronic
947508655 2:230730381-230730403 ACAGATATATTTTCATATAAAGG - Intronic
948057928 2:235023024-235023046 GTACCTTTATTTTCATGTAACGG + Intronic
948503330 2:238410530-238410552 ACCTTTGTATTTTAATGTAATGG - Intergenic
949081212 2:242101339-242101361 GCATGTGTGTCTTCATCTAAAGG + Intergenic
1168870772 20:1126396-1126418 CTATATGTATTTCCATGTCAAGG - Intronic
1169208067 20:3750937-3750959 GCATCTGTTTGTTCATGTAGGGG - Intronic
1169864155 20:10182252-10182274 GCATATGTATTTTCATGGGATGG - Intergenic
1169971035 20:11269819-11269841 GCCTATATATTTTAATTTAAGGG + Intergenic
1171249075 20:23635102-23635124 GCATATGTGTTTCCAAGTATAGG - Intronic
1174220470 20:48950413-48950435 GAATATGTATTTTCTTTCAATGG - Intronic
1174634138 20:51984389-51984411 CCATATCTATTTTCCTGTATTGG + Intergenic
1175002398 20:55643328-55643350 GCATATGTATTGGCTTGTATCGG - Intergenic
1176698556 21:10012510-10012532 GCATCTGAACTTTCTTGTAAAGG - Intergenic
1176798984 21:13403971-13403993 GCAAATGAATTTTTATGTAATGG - Intergenic
1177438444 21:21086414-21086436 ACATTTGTATTTACATGAAAGGG + Intronic
1177479303 21:21666012-21666034 GCATATCTATATTCACATAAGGG + Intergenic
1177796291 21:25781917-25781939 ACATATTTGTTTTCATGAAATGG + Intergenic
1180033972 21:45233025-45233047 ATAGATGTATTTTCTTGTAATGG + Intergenic
949147895 3:725675-725697 GTATCTGTATTTTCATGGGAGGG - Intergenic
949462837 3:4312243-4312265 GCATGTATATTATCAGGTAAAGG + Intronic
951244302 3:20322934-20322956 GCATTTACCTTTTCATGTAATGG + Intergenic
952489842 3:33857777-33857799 ATATATATATTTTCATGTTACGG - Intronic
953953607 3:47212814-47212836 GCATATGTATTTGAGTGAAATGG + Intergenic
954956490 3:54525078-54525100 TCATATGTATATACATATAATGG + Intronic
955426067 3:58791261-58791283 GCATATATATTTTTATTAAATGG - Intronic
955557839 3:60157014-60157036 CCATATTTATTTTCCAGTAAGGG - Intronic
956451456 3:69379043-69379065 GAAAATGTATTTTCATGTAAGGG - Intronic
956539275 3:70316623-70316645 CCATGTGTATTTTCATATCAAGG - Intergenic
957005588 3:74942405-74942427 CCATATATATTTTAATGTTATGG - Intergenic
957379652 3:79410216-79410238 TGGTATGTATTTTCACGTAATGG + Intronic
958766571 3:98375858-98375880 GAGTTTGTATTTTCATGTGAAGG + Intergenic
959780401 3:110225635-110225657 GCATATGTATATATATTTAAAGG + Intergenic
962171041 3:133101458-133101480 GGATATGTGGTTTGATGTAAAGG - Intronic
962826884 3:139106868-139106890 AGAGATGTATTTTCAAGTAATGG - Intronic
963124723 3:141804730-141804752 GCATATGTATGTGTATGTGAGGG - Intronic
963502255 3:146142524-146142546 GTAGATGTACTTTCATGTAAAGG + Intronic
963617728 3:147563767-147563789 GCAAATGTATTGTCTGGTAAGGG - Intergenic
964348807 3:155782264-155782286 GCATATGTTGGTTCATTTAATGG - Intronic
965491119 3:169337873-169337895 TCATCTTTATTTTCCTGTAATGG - Intronic
965873316 3:173286444-173286466 GCATATAAATTTGCATGAAATGG + Intergenic
965884991 3:173434345-173434367 GCATATGAATTACCAGGTAATGG + Intronic
966253894 3:177896683-177896705 GCAAATGTATTTTCATCCATAGG - Intergenic
966385520 3:179393755-179393777 GCTTAAGTACTTTCATATAAAGG - Exonic
967379395 3:188840791-188840813 GCATATGTAATTTCACATGATGG - Intronic
969981025 4:11154643-11154665 GCATTTGTATTATAATATAAAGG - Intergenic
970795173 4:19903950-19903972 GCAAATGTATTTACATTGAAAGG + Intergenic
970864913 4:20747262-20747284 ACATAAGTAATTTCAAGTAATGG + Intronic
971411059 4:26373138-26373160 GCATTTCCTTTTTCATGTAATGG + Intronic
971802566 4:31310918-31310940 TCATATTTATTTTCATGAACTGG + Intergenic
972192492 4:36611925-36611947 GCATATGTATGTTTATATATGGG - Intergenic
973323379 4:48832379-48832401 GCATATGCTTTTTCAATTAAGGG + Intronic
974006735 4:56565122-56565144 GGATGTGTATTTTGCTGTAATGG + Intronic
974778040 4:66512891-66512913 GCATATGCATTTTCTGATAAAGG - Intergenic
975259755 4:72284056-72284078 GCATCTGTATTTTTATTTTATGG + Intronic
976324314 4:83753242-83753264 GCATATGTATTTTACTAGAAAGG - Intergenic
976473343 4:85455026-85455048 GCATTTGTATTAACCTGTAATGG + Intergenic
977798955 4:101202679-101202701 CCATATGTATTTTTATTTGAAGG - Intronic
978287518 4:107095968-107095990 GCATATGGTTTTCCATGTAAGGG + Intronic
979013446 4:115400224-115400246 TCACATCTATTTTCATGTATAGG + Intergenic
979317934 4:119288549-119288571 ACTGATGTATTTTAATGTAATGG - Intronic
979617650 4:122762194-122762216 TCATATCTATAATCATGTAATGG + Intergenic
980656097 4:135788584-135788606 AGATATGTATCTTCAAGTAAAGG + Intergenic
980674757 4:136062651-136062673 GCATATCTATTTTGATGGTATGG - Intergenic
982857369 4:160401094-160401116 TCAAATGTATTTTCACATAATGG - Intergenic
983291088 4:165806617-165806639 GTATATGTATTCTCTTGTAAGGG - Intergenic
984684593 4:182652286-182652308 GCACAGGTATTTTCCTGTCAGGG + Intronic
986227032 5:5825460-5825482 ACATATGTACTTTCATGATAAGG - Intergenic
986294463 5:6425919-6425941 AAATATGTATTTTCTTGTGAAGG - Intergenic
987232914 5:15913749-15913771 ACACATGTATTTTCATGCAAAGG - Intronic
988453699 5:31368766-31368788 TCATATGGATTTTCATAGAAGGG + Intergenic
990129326 5:52560710-52560732 GGATATTTATTTTAATTTAATGG + Intergenic
990333457 5:54749709-54749731 GCATATGAATTTTGATGGAGAGG - Intergenic
990651896 5:57909603-57909625 TCATATGTTTTTTCATGTGGTGG - Intergenic
991345285 5:65659354-65659376 GGATCTTTATTTTTATGTAATGG - Intronic
991575157 5:68095291-68095313 GCATGTGTATGTTCATGTTCTGG - Intergenic
993398912 5:87424697-87424719 TCATATTTATTTTGAGGTAAAGG - Intergenic
994144514 5:96378861-96378883 GTATATGTATTTTTACCTAATGG + Intergenic
994335884 5:98565778-98565800 GTATATGTGTTTTCCTTTAAAGG + Intergenic
994596195 5:101839284-101839306 TCAAATGTATTTTGATATAATGG - Intergenic
996752196 5:126900165-126900187 GCACATGTAGTTTCTTGGAAAGG + Intronic
996922539 5:128785665-128785687 ACATATGTATATTCAGGTATAGG + Intronic
996969677 5:129349860-129349882 GCATATAAATATCCATGTAAAGG - Intergenic
997705700 5:135950132-135950154 GCATATATATGTTCATTAAAAGG + Intronic
1000126948 5:158254676-158254698 TTATATGTTTTTTCATTTAATGG + Intergenic
1000912756 5:167042133-167042155 TGATTTGTATCTTCATGTAATGG - Intergenic
1001906074 5:175474507-175474529 ACATATGTAATCTCAGGTAACGG + Intergenic
1002379350 5:178814654-178814676 GCCTATGTAGATTCATGCAAAGG + Intergenic
1004259880 6:14098578-14098600 GCATTTGTATTTTTACGTAGTGG + Intergenic
1004880867 6:20006726-20006748 GGATACATACTTTCATGTAATGG - Intergenic
1007894767 6:45342770-45342792 TCATATGTATTTTTTTGTATGGG - Intronic
1008928643 6:56914139-56914161 GCATATTTATTTTCTTTTTATGG - Intronic
1009297915 6:61977596-61977618 TCCAATGTATTTTCATGTGATGG - Intronic
1009893399 6:69716911-69716933 ACATATGTATTTATATGTACAGG + Intronic
1010100822 6:72106018-72106040 ACATATCTAATTTCATGTTATGG - Intronic
1011117581 6:83910651-83910673 ACATGTGTATATTCATGTACAGG + Intronic
1011333509 6:86235531-86235553 ATAAATGTATTTTCATGTCAAGG + Intergenic
1011621024 6:89242711-89242733 GGATATGCATTTTAATTTAAAGG - Intergenic
1011912749 6:92463363-92463385 GCACATATATTTGCATGTGAGGG - Intergenic
1013004799 6:106062383-106062405 AGATATGAATTTTCATGTTATGG - Intergenic
1013566444 6:111368963-111368985 GCTTAAGTCTTTTCATATAAAGG - Intronic
1013732280 6:113183006-113183028 GCACATTTATTTACATGTCAGGG - Intergenic
1013967566 6:115973044-115973066 CCTTTTGTATTTTAATGTAAAGG - Intronic
1013989084 6:116232296-116232318 GCATATGTATATACTTGTTATGG - Intronic
1015572688 6:134637705-134637727 GCAAAAGTATTTTTATGTGAGGG - Intergenic
1015792874 6:136981695-136981717 GCACATGAATTTTCATCTCAGGG - Intergenic
1015950598 6:138548917-138548939 GCATATATAATTTAATGTAGTGG + Intronic
1016742997 6:147547955-147547977 GAATATGAATTTTCTTTTAAAGG + Intronic
1017407034 6:154130681-154130703 GCATATATACTTTCATATAATGG - Intronic
1017739050 6:157389357-157389379 GCAGAAGTATTTGGATGTAAAGG - Intronic
1017795333 6:157839401-157839423 GCATATGTATTTTCATGTAATGG + Intronic
1018158423 6:161012589-161012611 ACATATGCATTTTCAGATAAGGG + Intronic
1024708919 7:51993729-51993751 TCACATGTAATTACATGTAAAGG - Intergenic
1025761124 7:64393673-64393695 ATATTTGTATTTTCTTGTAAGGG + Intergenic
1027601384 7:80245425-80245447 GCAGATGTATTTTCCTATATAGG + Intergenic
1027756238 7:82215491-82215513 TCATATTTATTTTCATGGAATGG - Intronic
1027845768 7:83372281-83372303 GCATTTTTTTTTTCAGGTAAAGG - Intronic
1028956393 7:96698303-96698325 GCACATGTATTCCTATGTAACGG - Intronic
1029991918 7:104970186-104970208 GAATATGTATTTTAATTTAGCGG + Intergenic
1030254629 7:107494974-107494996 GCATATGTATGTTAATGATAAGG - Intronic
1030453921 7:109748216-109748238 GGTTATGTATTTTCTTGTATTGG - Intergenic
1031221944 7:118977761-118977783 CCATATGTATCTTCCTGGAAGGG + Intergenic
1032249223 7:130239726-130239748 GTATATGTATTGACATGGAAAGG + Intergenic
1033970752 7:147035706-147035728 GACTCTGTATCTTCATGTAAAGG - Intronic
1035186815 7:157132807-157132829 ACATGTGTGTTTTCATGTCATGG + Intergenic
1035539122 8:418145-418167 GCATGTGTGTCTTCATGTAAAGG + Intronic
1035595555 8:854675-854697 GCATATGTGCTTTCATGCAGGGG + Intergenic
1038570868 8:28661492-28661514 ACATATATATATTCATGTTAAGG - Intronic
1038992397 8:32882569-32882591 GCATCTGTATTTTAAGTTAAGGG + Intergenic
1041518958 8:58733585-58733607 CCACATGTCTTTTCTTGTAATGG - Intergenic
1041527111 8:58818922-58818944 GAATTTGTATGTTTATGTAATGG + Intronic
1041585710 8:59515403-59515425 GTATATGTATTTACATATTAGGG + Intergenic
1041759785 8:61352429-61352451 GCATAATTATTTTTATGTTATGG - Intronic
1041858969 8:62489351-62489373 GAATATATATTTTCATTTAATGG - Intronic
1043052688 8:75403640-75403662 GCATTTTTATTTACAGGTAACGG + Intergenic
1045204334 8:100022115-100022137 ACAGATGGATTTTCATGTGAAGG + Intronic
1045859445 8:106798972-106798994 GCATATGAAGGTTCATGTAGAGG - Intergenic
1046377364 8:113402033-113402055 GTATATGTAAATTCCTGTAAAGG + Intronic
1046562626 8:115857353-115857375 GCATTTGAATTTTCAAGGAAAGG + Intergenic
1046678225 8:117136899-117136921 TCATTTGTATTTTCTTGTCAAGG + Intronic
1047053863 8:121142885-121142907 GCATAGGTAAATTCATGTCATGG - Intergenic
1050854051 9:10328327-10328349 GCAAATGCATTTTCAAGTACCGG - Intronic
1054316551 9:63595971-63595993 GCATCTGAACTTTCTTGTAAAGG - Intergenic
1054989632 9:71308505-71308527 GAATAGGTATTTTAATGAAATGG - Intronic
1056196212 9:84231248-84231270 GCTGATGTGTTTTCCTGTAAGGG + Intergenic
1058418119 9:104809035-104809057 GCATATGAATTTTTATAAAAAGG - Intronic
1058524315 9:105841604-105841626 AACTATGTATTTTCATGCAATGG + Intergenic
1061921698 9:133786114-133786136 GCATATGTATTCTCACGTGAGGG - Intronic
1185487388 X:493227-493249 GCATGTGCATTTGCATGTGAGGG - Intergenic
1186044769 X:5523451-5523473 GAACATGCATTTTCATTTAAAGG + Intergenic
1187349593 X:18500611-18500633 GCATTTGTATTTGTCTGTAAAGG + Intronic
1187473232 X:19587905-19587927 ACATATATATTTTCATATTATGG + Intronic
1187851003 X:23591701-23591723 TCATATGTATTGACATGAAACGG + Intergenic
1188018137 X:25127498-25127520 GCATATCTATGGTCATGTCAAGG - Intergenic
1188299572 X:28491083-28491105 ACTTCTGTATTTTCATGTATTGG + Intergenic
1188694481 X:33173361-33173383 GTTTATGTATTTTCATCAAAAGG + Intronic
1188784200 X:34324147-34324169 GTATGTGTCTTTTTATGTAATGG - Intergenic
1189859198 X:45254906-45254928 GTATATATATTTTTTTGTAATGG + Intergenic
1190415561 X:50177072-50177094 GCATTTGCATTTTCATTCAATGG - Intergenic
1193305590 X:79947534-79947556 CAATCTGTATCTTCATGTAAAGG - Intergenic
1193882362 X:86938652-86938674 ACAAATGTATTTTAATGTATGGG + Intergenic
1193891807 X:87056353-87056375 TCATATGAAATTTCAGGTAATGG + Intergenic
1194010872 X:88559455-88559477 GCAGATGTATTATCAGGGAAGGG + Intergenic
1194050259 X:89059397-89059419 GCATATGTATTTTTATGCTTAGG + Intergenic
1195315444 X:103672920-103672942 TCATATTTATGTTCATTTAAAGG + Intergenic
1196328082 X:114432812-114432834 GCAAATGTATATTGATGTGAGGG + Intergenic
1196825362 X:119736321-119736343 TCATATTTTATTTCATGTAATGG - Intergenic
1198923466 X:141758383-141758405 GCATATATACTTGCATATAAAGG + Intergenic
1202190188 Y:22234356-22234378 GCATCTGGGTTTTCATGTCAGGG - Intergenic