ID: 1017798462

View in Genome Browser
Species Human (GRCh38)
Location 6:157869582-157869604
Sequence GCTTAGCTCAGGGCGCTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 173}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017798462_1017798466 -5 Left 1017798462 6:157869582-157869604 CCTGCCAGCGCCCTGAGCTAAGC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1017798466 6:157869600-157869622 TAAGCTCTCATCCTCTTGCCTGG 0: 1
1: 0
2: 0
3: 14
4: 200
1017798462_1017798469 16 Left 1017798462 6:157869582-157869604 CCTGCCAGCGCCCTGAGCTAAGC 0: 1
1: 0
2: 0
3: 13
4: 173
Right 1017798469 6:157869621-157869643 GGACCATGCACCTTCCTCACTGG 0: 1
1: 0
2: 0
3: 27
4: 334

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017798462 Original CRISPR GCTTAGCTCAGGGCGCTGGC AGG (reversed) Intronic