ID: 1017803240

View in Genome Browser
Species Human (GRCh38)
Location 6:157918465-157918487
Sequence ACACATATACTGAAAGTAAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11628
Summary {0: 2, 1: 37, 2: 375, 3: 1542, 4: 9672}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017803240_1017803242 8 Left 1017803240 6:157918465-157918487 CCGTTTACTTTCAGTATATGTGT 0: 2
1: 37
2: 375
3: 1542
4: 9672
Right 1017803242 6:157918496-157918518 AATCAAGCTGTTTCTCTTATAGG 0: 1
1: 0
2: 2
3: 18
4: 267
1017803240_1017803243 20 Left 1017803240 6:157918465-157918487 CCGTTTACTTTCAGTATATGTGT 0: 2
1: 37
2: 375
3: 1542
4: 9672
Right 1017803243 6:157918508-157918530 TCTCTTATAGGCAAGATAGTTGG 0: 1
1: 0
2: 0
3: 12
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017803240 Original CRISPR ACACATATACTGAAAGTAAA CGG (reversed) Intronic
Too many off-targets to display for this crispr