ID: 1017804198

View in Genome Browser
Species Human (GRCh38)
Location 6:157929209-157929231
Sequence CAAACAAAGGAGAAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1007
Summary {0: 1, 1: 0, 2: 3, 3: 86, 4: 917}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017804198_1017804204 -1 Left 1017804198 6:157929209-157929231 CCTCCCTCCTTCTCCTTTGTTTG 0: 1
1: 0
2: 3
3: 86
4: 917
Right 1017804204 6:157929231-157929253 GTAGGCTTTCATTCTGCTGAAGG 0: 1
1: 0
2: 0
3: 19
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017804198 Original CRISPR CAAACAAAGGAGAAGGAGGG AGG (reversed) Intronic
900315110 1:2052435-2052457 AAAACAACAGGGAAGGAGGGAGG - Intronic
900932879 1:5747793-5747815 GAGAGAAAGGAGAAAGAGGGAGG + Intergenic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
901631389 1:10649853-10649875 CCCACAAAGGAGAGAGAGGGAGG + Intronic
901742423 1:11350948-11350970 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
901971706 1:12913677-12913699 GAAATAAAGGGGAAGGAGGGAGG - Intronic
902013462 1:13288063-13288085 GAAATAAAGGGGAAGGAGGGAGG + Intergenic
902043746 1:13510645-13510667 CAAATGCAGGAGGAGGAGGGAGG + Intronic
902118558 1:14142095-14142117 AAAAAAAAAGGGAAGGAGGGAGG - Intergenic
902150524 1:14439227-14439249 AATACAAAAGAGAAGGAGGAAGG - Intergenic
902682344 1:18052194-18052216 AAAACAAAGAAGAAGAAAGGGGG - Intergenic
903087563 1:20876241-20876263 AAAAAAAAAGACAAGGAGGGAGG + Intronic
903179730 1:21599109-21599131 CAAAGAAAGGAGGAGGCGGCAGG + Intronic
903604052 1:24561918-24561940 AAAAAAAAGAAAAAGGAGGGAGG + Intronic
903918544 1:26782645-26782667 CAGGCAAAGCAGAAGCAGGGAGG - Intergenic
903986795 1:27234667-27234689 TAAACAGAGGAGGAGGAGGGAGG + Exonic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904403183 1:30270169-30270191 GAAACCAAGGAGGAAGAGGGTGG + Intergenic
904455379 1:30644834-30644856 AAAGAAAAGGAAAAGGAGGGAGG - Intergenic
904653519 1:32024968-32024990 CAAACAAAAAAAAAGGCGGGGGG + Intronic
904745291 1:32707030-32707052 CAAACCCAGGAGGAGGAGAGAGG + Intergenic
904998521 1:34650214-34650236 AAAAGAAAAGAAAAGGAGGGAGG + Intergenic
905860627 1:41348628-41348650 CAAATAAAGTGGAAGGGGGGAGG + Intergenic
906796736 1:48702260-48702282 AAAACAAAGAAGAAGAAGAGGGG - Intronic
906994621 1:50778662-50778684 CAAACTGAAGAGAAGGAGGAAGG + Intronic
907746148 1:57215708-57215730 GGAATAAAGGAGATGGAGGGAGG - Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
908257058 1:62311508-62311530 TATGCAAAGGAGGAGGAGGGAGG - Intronic
908574503 1:65444662-65444684 AAAACAAAGGAGAGGAAAGGAGG + Intronic
908767744 1:67569690-67569712 AAAAAAAAGGAGAGGGAGTGGGG + Intergenic
909192968 1:72577546-72577568 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
909493286 1:76248795-76248817 CAAACAAAGGAAAAGAAAGAGGG - Intronic
909521488 1:76573650-76573672 AAAAAAAAGGAGAAGAAAGGGGG - Intronic
909686550 1:78355217-78355239 CAAAAAAAGGAGGAGGAGAAAGG - Intronic
910000076 1:82330979-82331001 CAATCAAAGGGTAAGGAGGGTGG + Intergenic
910051449 1:82978819-82978841 CAAAAACAGGAGAAGGGGTGAGG - Intergenic
910161852 1:84280890-84280912 AAAAGAAAGGAGAAAGAGGAAGG - Intergenic
910591717 1:88933402-88933424 AAAAAATAGGGGAAGGAGGGAGG + Intergenic
910980537 1:92956069-92956091 AAAAGAAAAGAAAAGGAGGGAGG + Intronic
911031738 1:93496240-93496262 GAAAAAGAGGAGAAGGAAGGGGG - Intronic
911122745 1:94312423-94312445 AAAAAAAAAAAGAAGGAGGGGGG - Intergenic
911201013 1:95043755-95043777 GAAGGAAAGGAGAAGGAGCGAGG + Intronic
911845330 1:102745646-102745668 CATCAAAAGGAGAAGGAGAGGGG - Intergenic
912201646 1:107464752-107464774 CATAAAAAGGTGCAGGAGGGTGG - Intronic
913379996 1:118200009-118200031 CTAACAAATATGAAGGAGGGTGG + Intergenic
913414178 1:118587077-118587099 GAAAAAAAGAGGAAGGAGGGAGG + Intergenic
913705652 1:121419485-121419507 GAAACAAAGGAGGAGAAGGAAGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
914938748 1:152003640-152003662 TGATCAAAGGAGAAGGAGGCTGG - Intergenic
914960132 1:152197623-152197645 GAAAGAAAGGAGGAGGGGGGAGG - Intergenic
915479950 1:156177663-156177685 AAAACAAAGGAAAAGGGAGGGGG - Exonic
915556549 1:156664043-156664065 GAAAGAAAGCAGAAGGAGAGGGG + Intergenic
915727067 1:158025492-158025514 GAAACAAAGGAGAGAGATGGGGG + Intronic
916084093 1:161255783-161255805 AAGCCAAAGGAGAAGGAGAGGGG + Intergenic
916282147 1:163063592-163063614 TAAACAATAAAGAAGGAGGGAGG + Intergenic
916593633 1:166219781-166219803 CACACAAAGGAGAAAGAGAAAGG - Intergenic
916659872 1:166913383-166913405 AGAACAAGGGAGTAGGAGGGTGG - Exonic
916990520 1:170239012-170239034 GAAACAAAGGAGAAGAGAGGAGG + Intergenic
917310018 1:173669305-173669327 TAAACAAAGGGCAAGGAGGCAGG + Intronic
917834631 1:178931593-178931615 AAAAGAGAGGAGAGGGAGGGAGG + Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918129776 1:181616734-181616756 CAAACAAAAAAAAAGGAGGTGGG + Intronic
918138734 1:181701951-181701973 CCAGCAGAGGGGAAGGAGGGTGG + Intronic
918264249 1:182825828-182825850 CAGACAAAGCAGAAGATGGGTGG - Intronic
918867145 1:189916696-189916718 CCAAAAAGGGAGAAGGTGGGAGG - Intergenic
919058855 1:192605957-192605979 GAAAGAAAGAAGAGGGAGGGAGG + Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919496875 1:198283492-198283514 AAAACAAAAGTGAAGGTGGGAGG - Intronic
919611999 1:199756946-199756968 CAAACAAAGCAGGAGGAAGAAGG - Intergenic
919928850 1:202208386-202208408 GAGAGAGAGGAGAAGGAGGGGGG + Intronic
920169744 1:204064386-204064408 AAAAGAAAGGAGGGGGAGGGAGG - Intergenic
920210767 1:204326733-204326755 CCAACCAAGGAGAAGGAAAGGGG - Intronic
920360326 1:205410990-205411012 GAAAGAAAAGAAAAGGAGGGAGG + Intronic
920951817 1:210579128-210579150 CAGACACGGGAGATGGAGGGTGG + Intronic
921784383 1:219211168-219211190 CACACAATGTGGAAGGAGGGAGG - Intronic
922033538 1:221826705-221826727 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
922235582 1:223720147-223720169 CCAAAAACGGAGAAGGAAGGAGG + Intronic
923276005 1:232396934-232396956 GAAAAAAAAGGGAAGGAGGGAGG + Intergenic
923566567 1:235080880-235080902 AAAAGAAAGAAAAAGGAGGGAGG + Intergenic
923811418 1:237321613-237321635 CAACCAAATGAGGAGGTGGGAGG + Intronic
923907329 1:238399801-238399823 CAAACACAAGAGAAGGTGGTAGG + Intergenic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924313090 1:242766543-242766565 CAAATAATTGAAAAGGAGGGAGG + Intergenic
924858650 1:247898955-247898977 CAAACAAAGGAGCAGTAAGTAGG + Intergenic
924917591 1:248589398-248589420 CAAACAAAAGAGAGGGAAAGTGG + Intergenic
1063542231 10:6945392-6945414 AAGAGAGAGGAGAAGGAGGGTGG - Intergenic
1063602991 10:7498810-7498832 CCAAAAGAGGAGGAGGAGGGAGG + Intergenic
1063646822 10:7893400-7893422 TAAACAGAGAAGAAGCAGGGAGG + Intronic
1064026623 10:11853712-11853734 GAAACGAAGGAGATGGAAGGAGG - Intronic
1064680004 10:17801203-17801225 CCAGCACAGGAGAAGGATGGAGG + Intergenic
1064927274 10:20582691-20582713 CAGAGAAAGTAGGAGGAGGGGGG - Intergenic
1065095124 10:22272798-22272820 CAAACAAAAAAAAAGGAGGGTGG - Intergenic
1065574688 10:27105466-27105488 CAAACATTGGTGAAGGAGGTGGG - Intergenic
1065830959 10:29613184-29613206 AAAAAAAAGAAGAAGGAGGAGGG + Intronic
1067226120 10:44376827-44376849 AGAACCAAGGAGGAGGAGGGAGG + Intronic
1067324660 10:45255984-45256006 CAGACACAGGAGGAGGATGGTGG + Intergenic
1067656129 10:48192985-48193007 AAAAGAAAGGAGGAGGAGAGCGG - Intronic
1068232774 10:54192219-54192241 GAAAGAAAGGAGAGGGAGAGAGG + Intronic
1068234034 10:54208977-54208999 CAAACAAAAGAGAGAGAGAGAGG - Intronic
1069078450 10:64063325-64063347 AAAAAAAAGGGGAAGGAAGGAGG - Intergenic
1069711956 10:70495336-70495358 CAAGAGAAGGAGAGGGAGGGAGG - Intronic
1069723722 10:70564754-70564776 CAAATGAATGAGGAGGAGGGAGG + Intronic
1069791526 10:71025848-71025870 AAAAAAAAAGAAAAGGAGGGAGG - Intergenic
1069817277 10:71206411-71206433 AAAACAAAGCAGGAGGAAGGAGG + Intergenic
1070030547 10:72672768-72672790 AAAATAGAAGAGAAGGAGGGGGG + Intergenic
1070118413 10:73551536-73551558 GAAACAAAGGAAAAGGAAGGGGG + Intronic
1070310056 10:75266432-75266454 CATTCAAAGGTGAAAGAGGGAGG - Intergenic
1070384149 10:75908831-75908853 CAAACAAAATAGAAGGAGCCTGG + Intronic
1070498564 10:77048480-77048502 GAAACAAAGGAGAATGGGGAGGG + Intronic
1070597918 10:77845651-77845673 GAAAGAAAGGGAAAGGAGGGAGG + Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071943225 10:90611234-90611256 CTAGCACAGGAGAAGGATGGAGG + Intergenic
1072167318 10:92826701-92826723 GAAACAAAGCAGAGGGAGTGAGG + Intergenic
1074087022 10:110215873-110215895 GAAAAAAAAGAGAGGGAGGGAGG + Intronic
1074777833 10:116779285-116779307 CAAACACAAGAGTAGCAGGGAGG + Intergenic
1075064551 10:119280768-119280790 AAAAAAAAAGAAAAGGAGGGAGG - Intronic
1075575932 10:123577476-123577498 GAAACAGTGGAAAAGGAGGGCGG + Intergenic
1076163875 10:128267006-128267028 AAACCAAAGGAGAAGGACTGAGG - Intergenic
1076459346 10:130629200-130629222 CTATTAAGGGAGAAGGAGGGAGG + Intergenic
1076757894 10:132583676-132583698 CAAATAAAGGAGAAAGTGTGGGG - Intronic
1076826325 10:132971417-132971439 CCAAAAAAAGAAAAGGAGGGAGG - Intergenic
1076870793 10:133192843-133192865 GAAAGAGAAGAGAAGGAGGGTGG + Intronic
1077245918 11:1538156-1538178 TAAAAAGAGGAGAAGGAAGGAGG - Intergenic
1077459409 11:2701063-2701085 CAAACACAGGAGGAAGGGGGAGG + Intronic
1077495855 11:2886163-2886185 CAGACAAAGGAGCCGGCGGGGGG - Intergenic
1077599452 11:3563820-3563842 CACACAAGGAATAAGGAGGGGGG + Intergenic
1077913175 11:6592063-6592085 CAAATAAAAGAACAGGAGGGGGG + Intronic
1077965685 11:7130360-7130382 GGAAGAAAGGAGAAAGAGGGAGG - Intergenic
1078106761 11:8362777-8362799 GAAAAAAAGGAGAAGGAAGCTGG - Intergenic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078657962 11:13260033-13260055 AAAACAGAGGAGAAGGAGGGAGG + Intergenic
1079470671 11:20774304-20774326 AAAAGAAAGGAGAGGAAGGGAGG - Intronic
1079524953 11:21374972-21374994 CAAACAGAGAAGAAGGAAGAAGG + Intronic
1079530932 11:21452113-21452135 AAAAGAAAAGAGAAGGAGAGAGG + Intronic
1079533917 11:21487532-21487554 CACACAAATGAGAAAGAGGAAGG + Intronic
1079551599 11:21705677-21705699 CAAAGAGAGAAAAAGGAGGGGGG - Intergenic
1079739829 11:24044053-24044075 GAAACAAAGGAGGGGGCGGGGGG - Intergenic
1079848014 11:25494740-25494762 CCAACACAGAAGAAGGATGGAGG + Intergenic
1080432115 11:32208953-32208975 AAAAAAAAGAAAAAGGAGGGAGG + Intergenic
1080657524 11:34269418-34269440 GAAACAAAGGAAAAGAAGGGAGG + Intronic
1080698767 11:34625854-34625876 CAAACAAAAAAAAAGAAGGGAGG - Intronic
1080843177 11:36003677-36003699 CAAATAAAGTAGAAGGAGAATGG + Intronic
1081638864 11:44739275-44739297 CAAAAAAAAGATACGGAGGGAGG - Intronic
1081710414 11:45212413-45212435 TACAAAAGGGAGAAGGAGGGAGG - Intronic
1081719561 11:45278022-45278044 CAACCAAGGAAGAAAGAGGGAGG + Intronic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081842512 11:46213297-46213319 TAAAAAAAGGAGAAGGACAGAGG - Intergenic
1083307597 11:61769338-61769360 CAAACCCTGGAGCAGGAGGGCGG - Intronic
1083931635 11:65849574-65849596 CAAACAAAGGTGAGGCAGTGCGG + Exonic
1084817393 11:71656870-71656892 CACACAAGGAATAAGGAGGGAGG - Intergenic
1084918358 11:72448756-72448778 CAAACAAATGAAAGGGAGGAAGG + Intergenic
1085532228 11:77198649-77198671 CAGACAGAGGGGAAGGAGAGGGG + Intronic
1085532341 11:77199375-77199397 CAGGCAAAGGAGAAGTAGGCCGG + Intronic
1086013765 11:82138836-82138858 CAAAAAGAAGAGAGGGAGGGGGG - Intergenic
1086144150 11:83533163-83533185 AAAACAAAGAAGAAAAAGGGAGG - Intronic
1086165425 11:83772435-83772457 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1086505663 11:87501385-87501407 CAAAAAGAGGACAAGGTGGGAGG + Intergenic
1086571632 11:88291504-88291526 CAAGAAAAGAAGAGGGAGGGAGG + Intergenic
1086990795 11:93302144-93302166 CAAAAAACGGAGGAGGAGGAGGG + Intergenic
1087414707 11:97839309-97839331 GAAGAAAAGGAAAAGGAGGGTGG + Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087811487 11:102613248-102613270 CACACAAAGGAAAGGCAGGGAGG + Intronic
1087944080 11:104137046-104137068 CAAACAATGGACCAGGAAGGAGG - Intronic
1088011157 11:105002420-105002442 AAGAAAAAGGAGAAGGAAGGGGG - Intronic
1088175944 11:107052523-107052545 CAATCATGGGAGAAGGAAGGAGG - Intergenic
1088306238 11:108411007-108411029 CAAAGAAAGTAAAAGGAAGGGGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088591588 11:111408229-111408251 GAAATAAATGAGAAGGAGAGGGG - Intronic
1088803501 11:113329482-113329504 CAATAAAATGAGAAGGAAGGAGG + Intronic
1088890705 11:114041949-114041971 AAACCAAAGGAGAAGGATGGGGG + Intergenic
1089853812 11:121523019-121523041 CACACAAATGGGAATGAGGGTGG - Intronic
1090078572 11:123595027-123595049 CACCCAAAGGGGAGGGAGGGAGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090966455 11:131601574-131601596 AAAAAAAAGGAGAGGGAAGGGGG - Intronic
1091199367 11:133762184-133762206 TAAACAAAGGAGCAGGAAAGAGG + Intergenic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1092127407 12:6084634-6084656 CTGACAAAGGAGAAGGGAGGGGG + Intronic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1092860063 12:12712609-12712631 CAAAGCAAGGAGAAAGAGGAAGG - Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093593684 12:20937672-20937694 CAAACAAGGGAGCAGTAGGCAGG + Intergenic
1093657523 12:21713108-21713130 AAAACAAGGGAGAAGGCAGGAGG + Intronic
1093739872 12:22672681-22672703 CAAACTAAAGAGAAGGAAAGGGG + Intronic
1093772560 12:23034506-23034528 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1094027488 12:25974254-25974276 GAAAGAAAGAAGAGGGAGGGAGG + Intronic
1094418656 12:30245734-30245756 CAAACAATGTGTAAGGAGGGTGG - Intergenic
1094670999 12:32569229-32569251 AAAACAGGGGAGAAGCAGGGTGG - Intronic
1095994480 12:48068760-48068782 CAAACAAGGTAGAAGGATGGAGG + Intronic
1096371039 12:51069269-51069291 AAAAGAAAGGAGAAGGAAGCCGG - Intronic
1096711978 12:53464317-53464339 TAAATAAAGGGGAGGGAGGGAGG - Intronic
1096765872 12:53888937-53888959 GAAAGAAAGAAGACGGAGGGAGG - Intergenic
1096766980 12:53899321-53899343 AGGAAAAAGGAGAAGGAGGGAGG + Intergenic
1097117711 12:56710372-56710394 AAAACAGAGGCCAAGGAGGGTGG - Intergenic
1097594866 12:61616658-61616680 CAGGCAAAGGAGAAGGAGATTGG - Intergenic
1097782140 12:63720206-63720228 CATACAAAGAACAAAGAGGGAGG - Intergenic
1097873949 12:64626009-64626031 CAACCAAAGGAGGGGGAGGTTGG - Intronic
1098086227 12:66847027-66847049 CCAATAAGGGAGAAGGATGGAGG + Intergenic
1098150948 12:67545604-67545626 CACACAACACAGAAGGAGGGAGG + Intergenic
1098504853 12:71237609-71237631 AAAAAAGAGGAGGAGGAGGGTGG - Intronic
1099201360 12:79681110-79681132 AGAAAAAAGGAGAAGAAGGGAGG + Intronic
1099351510 12:81575885-81575907 GAAACAAAAGAGAAGGAGTATGG - Intronic
1099398440 12:82170985-82171007 AAAAAGAAGGAGGAGGAGGGAGG + Intergenic
1099709006 12:86196147-86196169 CAAACCAAGGAGAGAGAGAGAGG - Intronic
1100683328 12:96955234-96955256 GAAACAGAGGCGAAGCAGGGTGG - Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101475523 12:105043360-105043382 CAAACAAACAAGAAAGAGGCAGG + Intronic
1101581880 12:106049100-106049122 AAAGCAAAGGAGAGAGAGGGAGG + Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102784574 12:115594141-115594163 CAAACTAAGCAGACAGAGGGGGG - Intergenic
1102808078 12:115799650-115799672 CAAAAAAAGAAGAAGAAGGGGGG + Intergenic
1102983723 12:117262448-117262470 CAGAGAGAGGAGAGGGAGGGAGG + Intronic
1103964930 12:124632650-124632672 CAAAGAGAGGAGAGGGAGGAAGG - Intergenic
1104521236 12:129477304-129477326 AAAACACAGGATGAGGAGGGGGG - Intronic
1104798447 12:131536545-131536567 CAAACAAGGGCGTAGGAAGGTGG + Intergenic
1104889723 12:132134484-132134506 CACACAAAGGAAGAGGTGGGAGG - Intergenic
1105642556 13:22280694-22280716 CAAAAAAAGGAAGAGGAAGGTGG + Intergenic
1105987934 13:25587955-25587977 AAAACAAAAAAAAAGGAGGGGGG - Intronic
1106367024 13:29091229-29091251 CAAACAAAAGAGAAAGGGGCAGG - Intronic
1106517239 13:30465672-30465694 CACACAAAGGCAAATGAGGGGGG - Intronic
1106783562 13:33085252-33085274 AAAAGAAAGAAGAGGGAGGGAGG + Intergenic
1107296477 13:38914480-38914502 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
1107486086 13:40828799-40828821 CAAGAAAAGAAAAAGGAGGGTGG + Intergenic
1107612023 13:42124757-42124779 AAAACAAAGGCGGAGGAGGGAGG + Intronic
1108933080 13:55854799-55854821 GAAACAAAGAAGAGGGAGGGAGG + Intergenic
1109010185 13:56930628-56930650 CAAATATAGGAGAAGGGAGGAGG + Intergenic
1109193777 13:59355810-59355832 ACAACAAAGGAGAAACAGGGAGG + Intergenic
1109406174 13:61903226-61903248 CAATCAAAGGGTGAGGAGGGCGG - Intergenic
1109670351 13:65598467-65598489 CAAACTCAGGAGAATGAAGGAGG + Intergenic
1110495512 13:76163239-76163261 GGAAAAAAGGAGCAGGAGGGAGG + Intergenic
1110567450 13:76970504-76970526 CAAAAAAAGGAGGTGGGGGGGGG + Intergenic
1110952337 13:81512170-81512192 CATATAAAAGACAAGGAGGGAGG - Intergenic
1110952419 13:81513669-81513691 CAAAGAAAGGAGGATGAGAGTGG - Intergenic
1111728270 13:92040570-92040592 AAACCAAAGGAGAAATAGGGTGG - Intronic
1112092100 13:96091965-96091987 CAAACCCAGGAAAAGGAAGGGGG + Intronic
1112100258 13:96180873-96180895 GAAAAAAAGGAGAAGGAAAGAGG - Intronic
1112221784 13:97498424-97498446 AATAGAAAGGAGAAGGAGGATGG - Intergenic
1112489090 13:99845835-99845857 AAAACGAAGGAGAAGAAGGACGG - Intronic
1112579876 13:100669459-100669481 CATACAAAGGAAAGGAAGGGAGG + Intronic
1112797513 13:103072317-103072339 CACACAAAGGGGAAAGAGTGGGG - Intergenic
1113167386 13:107457473-107457495 CAAGCACAGGAGAAGCAGGAAGG + Intronic
1113618064 13:111695039-111695061 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1113623597 13:111780300-111780322 CAGAGAGAGGAGAGGGAGGGCGG - Intergenic
1114164300 14:20203301-20203323 GAAACAAAGGAAAAAGAGGATGG - Intergenic
1114411483 14:22504684-22504706 CAAAAAAAGAAGAAGGAAGCTGG + Intergenic
1114464362 14:22910504-22910526 AAAGGAAGGGAGAAGGAGGGAGG + Intronic
1114879037 14:26760969-26760991 CCAACACAGGAGAAAGAAGGGGG - Intergenic
1115365132 14:32549378-32549400 CAGATAAAGGAAAAGGAAGGTGG + Intronic
1115873467 14:37833743-37833765 CACACAAAGGAGAAGGTGAAAGG - Intronic
1116885077 14:50212681-50212703 CAAACAGAGGAAATTGAGGGGGG + Intronic
1117184342 14:53225187-53225209 TAAACAAAGGAGAAGGAGAAAGG - Intergenic
1117416819 14:55504471-55504493 AAAACAAAGGGGAAGCAGGATGG - Intergenic
1118035977 14:61866296-61866318 CCAAAAAAGGAAGAGGAGGGTGG + Intergenic
1118245287 14:64104350-64104372 CAAGAAAAGGAGATGGAGGAGGG - Intronic
1118621776 14:67620266-67620288 CAGAGAATGGAGAGGGAGGGAGG + Intronic
1119213136 14:72847804-72847826 TAAAGAAAGGAGAATGAGGCTGG - Intronic
1119260725 14:73236821-73236843 AAAAAAAAAGAAAAGGAGGGAGG + Intergenic
1119643583 14:76331750-76331772 CAAACCAAGCAGAAAGAGGCAGG - Intronic
1120133264 14:80832674-80832696 CAAGCAAAGGAGAAGGAGTTGGG + Intronic
1120298382 14:82674612-82674634 CCAGCACAGGAGAAGGATGGAGG - Intergenic
1120397570 14:83987060-83987082 AAAACAAAGGAAAAGGAGTTTGG + Intergenic
1120778627 14:88464987-88465009 CAGAAACAGGAGGAGGAGGGAGG - Intronic
1121533728 14:94676799-94676821 AAAACAAAGGAGAACAAGGAAGG - Intergenic
1121843837 14:97156147-97156169 GAAAGAAAGGAGAGGGAGGGAGG - Intergenic
1122167139 14:99835562-99835584 CGAAGAAAGGAGAAGGAAGTAGG - Intronic
1122425769 14:101604578-101604600 CAAAGAAAGTGGATGGAGGGAGG + Intergenic
1122610914 14:102982959-102982981 AAAACAAAGGAGGTGGAGAGAGG + Intronic
1124029762 15:25999784-25999806 CAAAAAAAGGAGAGAGAGAGAGG - Intergenic
1124362260 15:29046389-29046411 CAAACAAGGGCAAAGGTGGGTGG - Intronic
1124563478 15:30795445-30795467 CAAATTAAGGTGATGGAGGGTGG - Intergenic
1124904708 15:33857742-33857764 CAGAGAAAGGAAAAGGAGTGGGG - Intronic
1126346240 15:47697209-47697231 GAAACAAGGGAGCAGGATGGAGG + Intronic
1126583292 15:50260315-50260337 AAAACAAAAAAGAAGGAGGCCGG - Intronic
1127446363 15:59067227-59067249 AAAAAAAAGGAAACGGAGGGAGG - Intronic
1127459301 15:59183257-59183279 AAAACAAGGTAGAAGGAAGGAGG + Intronic
1127689585 15:61381996-61382018 CCAACAAGAGAGAAGGAGAGGGG - Intergenic
1127693203 15:61418126-61418148 CAAGAAGAGGAGAAGGAGAGAGG + Intergenic
1127736159 15:61840837-61840859 CAAAGGAAGGAAAGGGAGGGAGG - Intergenic
1127852135 15:62923156-62923178 TAAACAAAGTGGAAGGAAGGTGG - Intergenic
1128095640 15:64952547-64952569 AGAACGAAGGAGAAGGAAGGAGG - Intronic
1128607145 15:69045493-69045515 GAAAGAAGGGAGAGGGAGGGAGG - Intronic
1128682341 15:69661178-69661200 CATCCACAGGAGCAGGAGGGAGG + Intergenic
1128940860 15:71786733-71786755 GAAAGAAAGAAGAAGGAGGAGGG + Intergenic
1129075162 15:72988736-72988758 AAAACTACGGGGAAGGAGGGAGG + Intergenic
1129306412 15:74667420-74667442 GAAAGAAAGGAGAAGGGGGGAGG + Intronic
1129431061 15:75502455-75502477 AAAAAAAAAGAGAGGGAGGGAGG + Intronic
1129448331 15:75634454-75634476 CATAGAAAGGAGATGGAGGGAGG + Intergenic
1129648277 15:77458934-77458956 CACAGAAAGGAGAAGGGGGTGGG - Intronic
1129837128 15:78716075-78716097 CAATCAAGGGAGATGGATGGGGG + Intronic
1130090350 15:80815608-80815630 GAAACAAAGGAGAAGGAATGAGG - Intronic
1130365650 15:83235954-83235976 AAAACAAGGGAGAAGTAGGGAGG - Intergenic
1130579567 15:85123940-85123962 CACAGAATGGAGAAGAAGGGAGG - Intronic
1131238319 15:90716678-90716700 CACACAAAGAGGAGGGAGGGCGG + Intergenic
1131591845 15:93758336-93758358 GAAACAAAGAAGGAGGAGGAAGG + Intergenic
1131660325 15:94507295-94507317 CAAACAAAGGAGAAAAAGAAAGG + Intergenic
1131668581 15:94595984-94596006 CATACATGGAAGAAGGAGGGGGG - Intergenic
1131852120 15:96554629-96554651 AAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1131901131 15:97088768-97088790 AAAAGGAAGGAGAAGGAGGAGGG - Intergenic
1132433396 15:101778255-101778277 CAAATTAAGGTGATGGAGGGTGG + Intergenic
1132538816 16:497687-497709 AAAACAAATGAGAAGGAAGACGG - Intronic
1132855878 16:2044338-2044360 TAAACAAAGGGAAAGGCGGGTGG + Intronic
1133288136 16:4700575-4700597 CACAGAAAGGAGGAGGATGGTGG + Intronic
1133530793 16:6653230-6653252 TAAACCAAGGAGAAGGGGGTGGG - Intronic
1133961260 16:10495550-10495572 AAAAAGAGGGAGAAGGAGGGAGG - Intergenic
1134068687 16:11247068-11247090 AAAAAAAAGGAGAAGGAGAAGGG - Intergenic
1134268271 16:12710454-12710476 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
1134667291 16:16028098-16028120 GGAACAAAGGAAAAGGAAGGCGG - Intronic
1134680684 16:16122892-16122914 CAAAAAAAGGAGATGGGGGTGGG + Intronic
1135521514 16:23182190-23182212 AAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1135718082 16:24790342-24790364 CAAACAAAGGAGGTGGTGTGTGG + Exonic
1135735326 16:24926855-24926877 CAAACACAGGAGACTGGGGGTGG - Intronic
1135879953 16:26245530-26245552 CATAGAGAGGAGAAGGAGGCTGG + Intergenic
1135934095 16:26764546-26764568 CCAGCACAGGAGAAAGAGGGAGG + Intergenic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136519903 16:30788527-30788549 AAAAAAAAAAAGAAGGAGGGAGG + Intergenic
1136589080 16:31206353-31206375 GAAAGAAAGAAGAAGGAGGAAGG - Intergenic
1137083546 16:36095781-36095803 CAAAATAAAGAGATGGAGGGAGG - Intergenic
1137827305 16:51510164-51510186 CTGACAAAGGAGAAGGAAGATGG - Intergenic
1138007676 16:53353509-53353531 CAAACAAGGGTGCTGGAGGGTGG - Intergenic
1138086690 16:54139995-54140017 CTAATAAATGAGAAGGAGGCAGG - Intergenic
1138901964 16:61283090-61283112 AAAACAAAGAAAAAGGAGGAGGG - Intergenic
1139193467 16:64891595-64891617 GAAAGAAAGGAGAAGGAAGAGGG + Intergenic
1139264306 16:65624693-65624715 GAGACAGAGGAGAAAGAGGGTGG - Intergenic
1139312244 16:66037406-66037428 CCAAGATAGGAGAGGGAGGGGGG + Intergenic
1139398221 16:66658194-66658216 CAAAGAAAGGGAAAGAAGGGAGG + Intronic
1139719365 16:68840398-68840420 CAAACAAAGAACATGGAGTGTGG - Intergenic
1140203746 16:72916176-72916198 AAAAGAAAGGCGGAGGAGGGGGG - Intronic
1141029459 16:80575038-80575060 CAAGCAAGGGAGACTGAGGGTGG + Intergenic
1141372479 16:83500566-83500588 AAAAAAAAAGAGGAGGAGGGAGG - Intronic
1141711555 16:85702421-85702443 AAAAAAAAAGGGAAGGAGGGAGG - Intronic
1141839307 16:86564453-86564475 CAAAGAAAGGAAAAGGGGAGGGG - Intergenic
1141845219 16:86603888-86603910 GAAAGGAAGGAGGAGGAGGGAGG - Intergenic
1141902820 16:87003716-87003738 GAAACAAAGGAGAGAGGGGGTGG + Intergenic
1142021036 16:87782769-87782791 CAAACAAAGCAAAAAGAGTGAGG - Intergenic
1142345301 16:89550162-89550184 CAAACAAAAAAGAATGACGGGGG - Intronic
1142441662 16:90102383-90102405 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1142542520 17:671363-671385 GAAAGAAAAGAGAAAGAGGGAGG + Intronic
1142899193 17:3001954-3001976 AAAAAAAAGGAGAAGAAGAGTGG - Intronic
1142928323 17:3260302-3260324 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143284795 17:5781093-5781115 GATACAAAGGAGACTGAGGGTGG + Intronic
1143569479 17:7746575-7746597 CAACCAAATGAAATGGAGGGTGG - Intronic
1143919555 17:10320076-10320098 GAAACAAGGGGGAAGGAGTGAGG + Intronic
1143965819 17:10755946-10755968 GGAAGAAAGGAAAAGGAGGGGGG - Intergenic
1145020927 17:19430092-19430114 CAAAACAAGGAGAAGCAGGGAGG + Intergenic
1145692331 17:26755569-26755591 CAAAGAAAGAAAAAGAAGGGAGG + Intergenic
1146133409 17:30297507-30297529 CAATCAAAGGGTGAGGAGGGCGG - Intergenic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1147266312 17:39236934-39236956 CAAACACAGTAGTAGGAGGTGGG + Intergenic
1147962976 17:44178929-44178951 TAAACACAGGAGGAGAAGGGAGG - Exonic
1148014262 17:44509993-44510015 AAAAAAAAAGAGAAGAAGGGAGG + Intergenic
1148268213 17:46243468-46243490 AAAAGAAAAGAAAAGGAGGGAGG + Intergenic
1148495218 17:48049352-48049374 GAAAAAAAGGAGAGGGATGGTGG - Intronic
1148514629 17:48204944-48204966 AAAAGAAAGAGGAAGGAGGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148838117 17:50477197-50477219 CAAACAAACGAAAAACAGGGCGG - Intergenic
1149098383 17:52872252-52872274 CAATCGAAAGAGAAGAAGGGAGG - Intronic
1149528355 17:57375820-57375842 GAATGAAAGGAGAAGGATGGGGG - Intronic
1150365154 17:64576204-64576226 CAAAAAAAAGAGAGGGAGGGAGG + Intronic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1151265623 17:72953010-72953032 GGAACAATGGAGAAGGAGAGGGG - Intronic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1151468040 17:74300355-74300377 CAGACATAAGAGAGGGAGGGAGG - Intronic
1151563965 17:74886847-74886869 CAAACTAAGGAGCAGGAAGGTGG - Intronic
1151858392 17:76738748-76738770 CAAACCAATGACAGGGAGGGGGG - Intronic
1151859010 17:76745143-76745165 CAAACAAAGCAAAACAAGGGTGG - Intronic
1152444091 17:80330562-80330584 GAAACACAGGAGACAGAGGGAGG - Intronic
1153298964 18:3576248-3576270 AAAAAAAAGGAGTTGGAGGGTGG - Intronic
1153684901 18:7535968-7535990 CCAACACAGGAGAAAGATGGAGG + Intergenic
1153795835 18:8621124-8621146 CAACCAAGGGACAAAGAGGGTGG - Intronic
1153815342 18:8785850-8785872 CAAACAAAGGACAAGGGTGGAGG - Intronic
1153815401 18:8786120-8786142 CAGAAAAAGGAGGGGGAGGGCGG - Intronic
1153865246 18:9261748-9261770 GGAAGAAAGGAAAAGGAGGGAGG - Intronic
1154494193 18:14944012-14944034 CAAGACAAGGAGAGGGAGGGAGG + Intergenic
1155630245 18:27884735-27884757 AAAACAAAGGGGAATTAGGGTGG + Intergenic
1155972993 18:32099244-32099266 AAAACAAAGCAGAAGTAGGAAGG - Intronic
1156495907 18:37525008-37525030 TTAACAAAGGAGAAGGGAGGAGG - Intronic
1156550477 18:38011143-38011165 CAAAGAAGACAGAAGGAGGGAGG + Intergenic
1157342870 18:46794901-46794923 CAAACCAAGCAGCAGGATGGAGG - Intergenic
1157399907 18:47378672-47378694 GAAACAGAGGAGATGAAGGGAGG - Intergenic
1157535253 18:48452941-48452963 CAAAGAAAGGGGAAGAAGAGAGG + Intergenic
1157654189 18:49369263-49369285 CAGGCAATGGGGAAGGAGGGTGG - Intronic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158073950 18:53506868-53506890 AAAAAAAAGGAGGAGGAGTGTGG + Intronic
1158299862 18:56039274-56039296 AAAACAAAGGAGAACCACGGAGG - Intergenic
1159879678 18:73846468-73846490 CAAACAAAAAACAAGCAGGGTGG + Intergenic
1160099244 18:75904873-75904895 CAAGCAAAGGAGAAGGAAACAGG + Intergenic
1160208608 18:76858357-76858379 CAAAAAAGGGAGAAGGGGGGAGG - Intronic
1160483243 18:79262119-79262141 CAAGGAAAGGGGAGGGAGGGAGG - Intronic
1160539603 18:79613368-79613390 CAAACAAAGCAGCAGCATGGAGG + Intergenic
1160925360 19:1542277-1542299 AAAAAGAAGGAGAAGGAAGGAGG - Intergenic
1161095548 19:2388391-2388413 CAAACAAAAAAGGAGGCGGGAGG + Intergenic
1161715019 19:5870983-5871005 CAAAAAAAAGAAAAGGAGCGAGG + Intronic
1162076466 19:8191154-8191176 CAAACAAAGAAGAAGAAGAAAGG - Intronic
1162154248 19:8666005-8666027 GAATCAAAGGAGAAGGGAGGAGG - Intergenic
1162226294 19:9225439-9225461 GAAAGAAAAGAGAGGGAGGGAGG + Intergenic
1162269656 19:9603859-9603881 AAAGAAAAGGAGAGGGAGGGAGG + Intergenic
1162334098 19:10049659-10049681 GAAAGAAAGAAGAAGGAAGGAGG + Intergenic
1162548071 19:11343011-11343033 CAAACCGTGGAGAAGGAGCGAGG - Exonic
1163093212 19:15035804-15035826 GGAAGAGAGGAGAAGGAGGGAGG + Intergenic
1163504251 19:17695484-17695506 GAAACAAAGAAAAAGGAGGGAGG + Intergenic
1163772029 19:19197070-19197092 CAAGGAGAGGAGTAGGAGGGTGG + Intronic
1164157083 19:22603451-22603473 CAAAGCCAGGAGAAGGGGGGTGG + Intergenic
1164168304 19:22701531-22701553 CAAATGAAGGAGAAGGAAGTAGG - Intergenic
1164216492 19:23155164-23155186 CAAACAAAGGAGCAGTAAGCAGG + Intergenic
1164609515 19:29622567-29622589 CTACCAAAAGAGAGGGAGGGAGG + Intergenic
1164631764 19:29766507-29766529 CAAAAAAAGAAGAAGGAAGAAGG - Intergenic
1165249898 19:34521847-34521869 AAAAAAAAGGAGAAAGAGAGAGG - Intergenic
1165686754 19:37828613-37828635 GAAACAAAGAACAAAGAGGGAGG + Intergenic
1166325870 19:42050866-42050888 CAAGCTCAGGAGAGGGAGGGAGG + Intronic
1166329338 19:42069520-42069542 CAAATGGAGGGGAAGGAGGGAGG + Intronic
1166649371 19:44560134-44560156 AAAGAAAAGGAGAAAGAGGGAGG + Intergenic
1166772562 19:45292871-45292893 CAAAAAAAGTAGAAGGGAGGAGG + Intronic
1167254405 19:48418651-48418673 CCAGCGAGGGAGAAGGAGGGAGG + Intronic
1167883436 19:52481326-52481348 TGAACAAAGGAGAAGGAACGCGG + Intronic
1168257017 19:55172731-55172753 GAAAAAAAAGAGAGGGAGGGAGG + Exonic
1168350386 19:55672334-55672356 CCAGCAAAGAAAAAGGAGGGGGG - Intronic
1168569424 19:57453133-57453155 AAAAGAAAAGAGCAGGAGGGAGG - Intronic
1168675486 19:58275030-58275052 CAAATAAGGGAGAAAGGGGGTGG + Intronic
925031615 2:654199-654221 CAGACACTGGAGAAGGTGGGAGG + Intergenic
925923181 2:8651722-8651744 CAAAAAGAGGAGAGGGAGGGAGG + Intergenic
925949445 2:8897325-8897347 CATCCAAAGGGGAAGGAGAGGGG - Intronic
926221870 2:10941707-10941729 GAAACCCAGGAGAAGGATGGAGG + Intergenic
926229094 2:10989383-10989405 GAAACAAAGGAGAAGGACCCCGG - Intergenic
926411106 2:12603916-12603938 CAAGCAAGGGAGAGAGAGGGAGG + Intergenic
926726928 2:16005675-16005697 AAGAAAGAGGAGAAGGAGGGTGG - Intergenic
927099864 2:19779854-19779876 CAACCAAGGGGGAAGCAGGGAGG + Intergenic
927164723 2:20306498-20306520 CAAACAAGGGATAAAGCGGGTGG + Intronic
927194059 2:20535698-20535720 CCAACACAGGAGAAGGGGGCAGG + Intergenic
927934886 2:27070853-27070875 CAAACTATAGAGAAGGAAGGGGG - Intronic
928323028 2:30298449-30298471 TAAAGAAAGGGGAAGGAGGATGG + Intronic
928469940 2:31564463-31564485 AAAAGAAAGGAGAAGTAGGGAGG + Intronic
928660882 2:33500638-33500660 TAAAAAAATGAGAAGGAGGTGGG + Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929103165 2:38337087-38337109 CAAGAAAAAGAGAGGGAGGGAGG + Intronic
929113913 2:38428485-38428507 AAAAAATAGAAGAAGGAGGGTGG - Intergenic
929755174 2:44758247-44758269 CAAAGAAAGTAGATGGAGAGGGG + Intronic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
929912003 2:46097890-46097912 CTAACAAAGGGGAAGGGAGGAGG + Intronic
930312257 2:49755965-49755987 GAAAGAAGGGAGAGGGAGGGAGG + Intergenic
930818404 2:55621608-55621630 CAATCAAAGGGTGAGGAGGGTGG - Intergenic
931077998 2:58737883-58737905 GACACAAAAGAGAAGGTGGGAGG + Intergenic
931799667 2:65746601-65746623 CAAGCAAAGGATAAGTACGGCGG - Intergenic
932300570 2:70664070-70664092 CAGAGAAAGGAGAAGGCGTGAGG + Intronic
932769350 2:74491935-74491957 TAAACAAAGGAGAAGGATTTGGG + Intronic
933067648 2:77818354-77818376 GAAAGAAAAGAAAAGGAGGGAGG - Intergenic
934104364 2:88682258-88682280 CAAACAGAGGAGAAAAAGGGGGG - Intergenic
934122886 2:88857215-88857237 AAAGCCAAGGAGGAGGAGGGGGG + Intergenic
934509838 2:94928761-94928783 CAAAAAAAAAAAAAGGAGGGGGG + Intergenic
934880437 2:97972428-97972450 GAAAGAAAGGGGAGGGAGGGAGG + Intronic
934995374 2:98953096-98953118 AAAGAAGAGGAGAAGGAGGGCGG - Intergenic
935338905 2:102042369-102042391 GAAAGAAAGGAGAGGGAAGGAGG + Intergenic
935903566 2:107818365-107818387 AGAAGAAAGGAGAAGGAAGGAGG - Intergenic
936016811 2:108965640-108965662 CACCCAAATGAGAAGGAAGGAGG - Intronic
936432282 2:112474912-112474934 CAAAGAAGAGAGATGGAGGGAGG + Intergenic
936709508 2:115115925-115115947 CAAAAAAAGCAGAAGGAAAGTGG + Intronic
937182935 2:120012675-120012697 CCTACAAAGGAGAAAAAGGGAGG + Intergenic
937755680 2:125535361-125535383 CAACCAAAAGAGAAGGAGTGAGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938154502 2:128921411-128921433 AAAGAAAAGGAGAAGGAGGAAGG - Intergenic
938235618 2:129704166-129704188 CCAGAAGAGGAGAAGGAGGGAGG - Intergenic
938380433 2:130833457-130833479 AAAAGAAAAGAAAAGGAGGGAGG + Intergenic
938548778 2:132360675-132360697 CAAACAAAAAACAAAGAGGGAGG + Intergenic
938676066 2:133635207-133635229 CAGACAGAGGAAAAGGAAGGGGG + Intergenic
938839378 2:135144228-135144250 CAATCAAAGGGTAAGGAAGGTGG + Intronic
939569217 2:143820339-143820361 AAAATAAAGGAAAAGAAGGGAGG + Intergenic
939949108 2:148447227-148447249 GAAAGAAAGGGAAAGGAGGGAGG + Intronic
939967367 2:148623682-148623704 CAAGAAAAGGAGAAGAAGGATGG - Intergenic
940332468 2:152490178-152490200 CAAAAAAAGGGGAAAGAGGAGGG + Intronic
940530632 2:154872605-154872627 CAAATAAATGTGGAGGAGGGCGG - Intergenic
940626308 2:156179747-156179769 CAAGTAAAAGAGAAGGAAGGTGG + Intergenic
943033155 2:182709874-182709896 CAAACAAAAGAGAAGGCAGTAGG - Intergenic
943117062 2:183685958-183685980 CCACCAATGGTGAAGGAGGGGGG + Intergenic
943509355 2:188804596-188804618 CCAGCAAAGGAGAAAGATGGAGG - Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944218568 2:197279655-197279677 CAAACTAGGAAGAAGGAGGAAGG - Intronic
944401283 2:199328978-199329000 CAAACAAAGGAGGAGAGGGGTGG - Intronic
944481721 2:200164194-200164216 CAACCAAAGGTGAAGCAGGGAGG + Intergenic
944711462 2:202338506-202338528 AAAACAAAGAAAAAGGAGGGAGG - Intergenic
945085704 2:206129951-206129973 AAAAAAAAGGAGGAGGAGTGGGG + Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945493001 2:210477602-210477624 CAAACTTAGGCCAAGGAGGGAGG - Intronic
945576508 2:211536618-211536640 GAACCAAAGAAGATGGAGGGAGG + Intronic
945893855 2:215459991-215460013 GAGACAGAAGAGAAGGAGGGAGG - Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946410907 2:219514773-219514795 AAACCCAAGGAGAAGGAGGCAGG + Exonic
946687975 2:222290932-222290954 AAAAAAGAGGAGAAGAAGGGGGG + Intronic
946730777 2:222707382-222707404 AAAAGAAAAGAGAAAGAGGGAGG + Intronic
946960192 2:224976822-224976844 CAAAAGAAGGAGGAAGAGGGTGG - Intronic
947147020 2:227077703-227077725 AAAAAAAAGAAGGAGGAGGGAGG + Intronic
947389113 2:229621705-229621727 CAAACAAAGGGCAAGGAGTGAGG - Intronic
947480206 2:230492285-230492307 CAAACAAACGAAAAACAGGGAGG - Intronic
948286004 2:236785893-236785915 CAAATAAAGGAAAGGGTGGGAGG - Intergenic
948312408 2:236998429-236998451 TAAACAAAGAAGGAGGAAGGGGG + Intergenic
948570880 2:238916475-238916497 GAAAGAAAGAAGGAGGAGGGAGG + Intergenic
948705841 2:239792047-239792069 GAAACAGAGGAGGAGGAGTGAGG + Intronic
948977835 2:241474492-241474514 GAAACAAGGGAGAAGGTGGCCGG + Intronic
1168995887 20:2132967-2132989 CAAACAAAATAGCAGGATGGGGG - Intronic
1169204951 20:3734167-3734189 CAAAAAAAGGAGCGGGAGTGGGG + Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1170032706 20:11959354-11959376 GAAAGAGAGGGGAAGGAGGGTGG + Intergenic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170370240 20:15640278-15640300 GAAATAAAGGAAAAGGAGAGAGG + Intronic
1171161187 20:22925202-22925224 GACACAAAGGAAAAGGAGAGGGG - Intergenic
1171877608 20:30593210-30593232 AAAACAAAGAGGGAGGAGGGAGG + Intergenic
1173061432 20:39665353-39665375 CAAACAAGGAAGAAGGACAGAGG + Intergenic
1173219827 20:41123169-41123191 CAAACAAAGGAGAAATAAGGGGG - Intronic
1173340706 20:42150305-42150327 CAAGCAAAGGAGAGTGAAGGGGG - Intronic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173425476 20:42939446-42939468 GAAGGAAAGGAAAAGGAGGGGGG - Intronic
1173469476 20:43311669-43311691 CACAAAAGAGAGAAGGAGGGGGG + Intergenic
1173594629 20:44250785-44250807 CCCACAAAGGAGGAGGAGGCTGG - Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173952772 20:47006326-47006348 TTCACAAAGGAGAAGGAGGCAGG + Intronic
1174033872 20:47653612-47653634 GATACACAGCAGAAGGAGGGGGG - Exonic
1174185718 20:48704556-48704578 AAAAAAAAAGAGAGGGAGGGAGG - Intronic
1174370855 20:50086321-50086343 TAAACACAGAAAAAGGAGGGTGG + Intronic
1174414766 20:50359364-50359386 CAAACTATGGGGAAGAAGGGAGG + Intergenic
1174602523 20:51736226-51736248 AAGATAAAGGACAAGGAGGGAGG + Intronic
1174638543 20:52023020-52023042 CAAAGAAAGCAGAAGGAAGAAGG - Intergenic
1174795885 20:53522339-53522361 CAAACAAAGGAAAAGAATGATGG - Intergenic
1175235094 20:57504270-57504292 AAAAAAAAGGAGACGGGGGGCGG - Intronic
1175333602 20:58180803-58180825 CACAGAAAGAAGCAGGAGGGAGG - Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175775709 20:61652271-61652293 TATACAAAGGAGTAAGAGGGTGG - Intronic
1176286878 21:5023060-5023082 AGAAGAAGGGAGAAGGAGGGAGG + Intronic
1176362063 21:6006180-6006202 CAAAAGGAGGAGGAGGAGGGGGG + Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1176920634 21:14683713-14683735 CAAACAAGCGAGAGGGAGGGAGG + Intergenic
1176926044 21:14750160-14750182 CCAACAAAAGGAAAGGAGGGTGG + Intergenic
1177161669 21:17554480-17554502 CAAACCAAGGAGGGGGAGAGGGG + Intronic
1177670174 21:24214571-24214593 AAAACAAAAGAAAGGGAGGGAGG + Intergenic
1178370684 21:32024812-32024834 CCAACACAGGAGAAAGATGGAGG + Intronic
1178465468 21:32843594-32843616 CATACAAACCAGAAGGTGGGAGG + Intergenic
1178731850 21:35110899-35110921 CAAACAAGGGAGAAAAAAGGAGG + Intronic
1179713353 21:43275413-43275435 CAAGCAGAGCAGATGGAGGGAGG - Intergenic
1179761455 21:43532365-43532387 CAAAAGGAGGAGGAGGAGGGGGG - Intronic
1179773771 21:43645758-43645780 CAAACAAACGAGAAGCGGGTAGG + Intronic
1179870303 21:44240415-44240437 AGAAGAAGGGAGAAGGAGGGAGG - Intronic
1181289993 22:21784363-21784385 GAAAGAAAGGAGGAGAAGGGAGG + Intronic
1181829488 22:25548353-25548375 TAAAAGAGGGAGAAGGAGGGAGG + Intergenic
1181844722 22:25698063-25698085 GGAAAAAAGGAGAGGGAGGGAGG + Intronic
1181879731 22:25968604-25968626 CAAAGAAAGGAAATGGAGGCCGG + Intronic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182679872 22:32070308-32070330 CAAAGAAAGTAGAAGGAAGAAGG - Intronic
1182878992 22:33717145-33717167 TAAATGAAGGAGATGGAGGGAGG - Intronic
1183184137 22:36282210-36282232 CAAAGAAAGGAGGAGGAGTGGGG + Exonic
1184178538 22:42803886-42803908 AAAAAAAAGAGGAAGGAGGGAGG - Intronic
1184903370 22:47461918-47461940 AAAACAAAGAAGAAGAAGGTTGG + Intronic
1184917172 22:47577728-47577750 CAAAAACAGGAAAGGGAGGGAGG + Intergenic
1185002497 22:48254420-48254442 CAAAGAAGGAAGAGGGAGGGAGG + Intergenic
1185036957 22:48484486-48484508 AGAAGGAAGGAGAAGGAGGGAGG - Intergenic
949159403 3:861493-861515 CAAACAAAGGAGCAATAGGAGGG - Intergenic
949188122 3:1218285-1218307 GGAGCCAAGGAGAAGGAGGGTGG + Intronic
949190840 3:1246818-1246840 GAAACCAAGGGGAGGGAGGGAGG - Intronic
949214281 3:1546583-1546605 CAAGCAAGGGAGAATGAGGAGGG + Intergenic
949822741 3:8133858-8133880 CCAAGAAAGGAGAGGAAGGGAGG + Intergenic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950394016 3:12719684-12719706 GAGACAGAGGAGAAGGAGAGAGG + Intergenic
950751176 3:15129322-15129344 CACACAAGGAATAAGGAGGGAGG - Intergenic
951269700 3:20608784-20608806 CATCCATAGGAGAAGGAGGAAGG + Intergenic
951490953 3:23270138-23270160 AAAAAAAAGGAGGAGGGGGGTGG - Intronic
951679936 3:25284060-25284082 CAGCAAAATGAGAAGGAGGGAGG - Intronic
951991836 3:28683888-28683910 CCAACACTGGAGAGGGAGGGAGG - Intergenic
952276894 3:31886023-31886045 GAAAGAAAGGAGAAGGAGATGGG + Intronic
952344164 3:32468545-32468567 CAAAAAATAGGGAAGGAGGGAGG - Intronic
952433277 3:33246927-33246949 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
952787944 3:37175164-37175186 GAAACAAGAGAGAAGGAGAGCGG - Intronic
953639015 3:44688245-44688267 CAAATAAGGGAGAAAGGGGGTGG - Intergenic
953664932 3:44918585-44918607 CAAACACAGCAGAAGGACGATGG + Intronic
953859794 3:46533761-46533783 GAAAGAAAAGAGAGGGAGGGAGG - Intronic
954462671 3:50636663-50636685 AAAACAAAGGATGAAGAGGGAGG + Intronic
954581934 3:51707627-51707649 CAAGCGAGGGAGAAGCAGGGAGG - Intronic
954626315 3:52023865-52023887 CAGCCAGGGGAGAAGGAGGGAGG - Intergenic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955695616 3:61633023-61633045 CAAATCAAGAAGAAGGATGGTGG - Intronic
955756299 3:62228224-62228246 AAAACAAAGAAAAAGGAGGCTGG + Intronic
956047016 3:65206630-65206652 CAAGCAAATGAGAAAGAGTGAGG + Intergenic
956147837 3:66210116-66210138 TAGAAAAGGGAGAAGGAGGGAGG - Intronic
956457130 3:69433416-69433438 TAAAAACAGGACAAGGAGGGAGG + Intronic
956698938 3:71942000-71942022 GAAAAAAAAAAGAAGGAGGGAGG - Intergenic
956768556 3:72505293-72505315 AGGACAAAGGAGAAGGAGGAAGG + Intergenic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
956919697 3:73913924-73913946 CAAACAAGGGAGAAAGGGGGTGG - Intergenic
957470139 3:80648723-80648745 TAAACAAAGGAGAAAAAGGAAGG - Intergenic
957539894 3:81554166-81554188 CACACAAAGGAAATGGTGGGGGG + Intronic
957588744 3:82167827-82167849 GAAGCAAAGGAGAAAGAGGTTGG - Intergenic
957938074 3:86969341-86969363 CAAGCAAAGCAAATGGAGGGAGG - Intronic
958781467 3:98548481-98548503 CAAAGAAAGGGGAGGGAGGGAGG + Intronic
958827075 3:99042946-99042968 CATACAAAGGAGAAAGAGAAAGG + Intergenic
959034658 3:101346940-101346962 TAAAAAAAGGAGGAGGAGGGAGG + Intronic
959057322 3:101581100-101581122 CAAACAGAGCAGAGTGAGGGTGG - Intronic
959235304 3:103713831-103713853 TAAAGAAAGAAGAGGGAGGGAGG + Intergenic
959314199 3:104781587-104781609 CAAACAAGAGAGAAAGAGAGAGG + Intergenic
959578213 3:107957703-107957725 CAAGGAAAGGAGGAGGAGGAGGG + Intergenic
959936664 3:112036566-112036588 CAAAAAAAAAAAAAGGAGGGGGG + Intronic
960356181 3:116656189-116656211 TAAAGAAGGGAGAGGGAGGGAGG - Intronic
960437798 3:117648323-117648345 CAAACAGTGAAGAAGGAGTGTGG + Intergenic
960598666 3:119432870-119432892 CAAAGACAGGATAAGGAGGAAGG + Intronic
961004559 3:123396157-123396179 AAAAGAAAAGAGAAGAAGGGAGG + Intronic
961283816 3:125784072-125784094 CACACAAGGAATAAGGAGGGAGG - Intergenic
961299063 3:125910333-125910355 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
961954493 3:130787546-130787568 CACCCGCAGGAGAAGGAGGGTGG + Intergenic
962256414 3:133872918-133872940 CAAAAGAAGGTGAGGGAGGGAGG + Intronic
962597424 3:136960801-136960823 AAAACAAGGTAGAAGAAGGGAGG + Intronic
962694059 3:137930245-137930267 GAAAGAAAGAAAAAGGAGGGAGG + Intergenic
962938075 3:140100000-140100022 AAAACGAAGGAGAAAGAGGATGG - Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963021550 3:140876787-140876809 CATCAAAAGGAGAAGGAGAGGGG + Intergenic
963108410 3:141665605-141665627 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963108448 3:141665751-141665773 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963108528 3:141666001-141666023 GAAGGAAAGGAGAGGGAGGGAGG + Intergenic
963283708 3:143412479-143412501 CAAACACCGGAGAAGGAGCCTGG - Intronic
964081634 3:152765869-152765891 CAAACAACTGAAAAGGAGGGAGG + Intergenic
964367812 3:155968439-155968461 GAACAAAAGGAGAAGGAGGTTGG + Intergenic
964469418 3:157036644-157036666 CCAACACAGGAGAGGGATGGAGG + Intronic
964525692 3:157613579-157613601 CGAGGAAAGGAAAAGGAGGGAGG + Intronic
964839744 3:160980769-160980791 AAAGAAAAGGAGAGGGAGGGAGG + Intronic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965420017 3:168446390-168446412 AAAAGAAAGGAGGAGGAGAGAGG - Intergenic
965874807 3:173303419-173303441 CATAGAGAGGAGAAAGAGGGAGG + Intergenic
966268775 3:178080184-178080206 CATGAAAAGGAGAAGGTGGGAGG - Intergenic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
966542297 3:181105681-181105703 CCAATAGAGGAGAATGAGGGTGG + Intergenic
966819241 3:183911753-183911775 AAAACAAAGGAGAAAGAAAGAGG - Intergenic
966958564 3:184910093-184910115 CAAAGAAAAGAGAAAGAGGAAGG - Intronic
967000351 3:185327979-185328001 GAAAGAAGGGGGAAGGAGGGAGG + Intronic
967095530 3:186174445-186174467 GAAAAAAAGGAGAAGGTTGGGGG + Intronic
967498868 3:190174744-190174766 GAAAGAGAGAAGAAGGAGGGAGG - Intergenic
967729745 3:192896354-192896376 CAAAAAAAGGCGAAGGACGCTGG - Intronic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968186375 3:196635710-196635732 CAAAGAAAGGAGGAGGAGGCCGG - Intergenic
968361918 3:198153350-198153372 CAAACAAAAAAGAAGGAAGACGG + Intergenic
968465910 4:750932-750954 GAAACAAATGACAGGGAGGGTGG - Intronic
969013889 4:4090137-4090159 CACACAAGGAATAAGGAGGGAGG + Intergenic
969395787 4:6920263-6920285 AAAACAAAGGAGAGAAAGGGAGG - Intronic
969667012 4:8564927-8564949 CAAACAAAGGAGAGGGCGTGGGG - Intronic
969740096 4:9018298-9018320 CACACAAGGAATAAGGAGGGAGG - Intergenic
969799260 4:9549807-9549829 CACACAAGGAATAAGGAGGGAGG - Intergenic
970490167 4:16564048-16564070 AAAAGAAAGGAGAATGAGGGAGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970932095 4:21524063-21524085 AAAATAAAGGAGGAGGAGAGAGG - Intronic
971122076 4:23715908-23715930 AAAACAAAGCAGAAGCAGTGTGG + Intergenic
972789458 4:42357230-42357252 TAAAGAAAGGAGAGAGAGGGAGG + Intergenic
972798591 4:42448379-42448401 GAAAAGAAAGAGAAGGAGGGAGG - Intronic
973179669 4:47252097-47252119 CATCCAGAGGAGTAGGAGGGGGG - Intronic
973337439 4:48970939-48970961 AAAATAAAGGAAAAGCAGGGAGG - Intergenic
973671402 4:53222146-53222168 AAAACAAAGGTGAGGGTGGGCGG - Intronic
974385869 4:61201582-61201604 CAGAGAAAGCAGCAGGAGGGTGG - Intronic
974456771 4:62138777-62138799 CAATCAAAGGGTGAGGAGGGTGG + Intergenic
974836297 4:67255132-67255154 CAAACAATAGAAAAGGAAGGAGG - Intergenic
975092076 4:70415794-70415816 GAAACAAAGGCCAAGGCGGGTGG - Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
975730508 4:77333167-77333189 GAAACAAAGTACAAGGAGGTAGG + Intronic
975870018 4:78769633-78769655 AAAAAAAAGAAGAGGGAGGGCGG + Intergenic
975947658 4:79727080-79727102 AAAACAGAGAAGAAAGAGGGAGG + Intergenic
976057458 4:81084875-81084897 CAAGCAAATGAGAGGGAGAGAGG + Intergenic
976122547 4:81799355-81799377 CAAACAAAGATCAATGAGGGAGG + Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
977545667 4:98373408-98373430 AAAACAAACAAGAGGGAGGGAGG - Intronic
977566872 4:98589457-98589479 CAGACAAAGGAAAGGGAAGGAGG + Intronic
977745174 4:100538475-100538497 CAGAGAAATGAGCAGGAGGGTGG + Intronic
977840059 4:101691878-101691900 CAAACAAGAGAGAAAGAGAGAGG + Intronic
978234577 4:106443269-106443291 GAAAGAGAAGAGAAGGAGGGAGG - Intergenic
978740137 4:112127742-112127764 TACACAGAGGAGAAGCAGGGTGG - Intergenic
979466718 4:121048038-121048060 CAAACAAAAGAGGAGCAGAGGGG - Intronic
979814650 4:125085754-125085776 CAAGCAAAGAAGAGGGAGAGAGG - Intergenic
979831557 4:125311673-125311695 AAAAAAAAGGAGAGGGAGAGAGG + Intergenic
980145489 4:128978561-128978583 ACAACCAAGGAGAATGAGGGAGG + Intronic
980698652 4:136394932-136394954 CAAGCCAAAGAAAAGGAGGGTGG + Intergenic
980888961 4:138793777-138793799 GAAAGAAAGGAGAAGAGGGGAGG + Intergenic
980912564 4:139006891-139006913 CAAAAAAAGGAGGAGGATGGGGG - Intergenic
980977956 4:139629170-139629192 ATAATAAAGGAGGAGGAGGGGGG - Intergenic
981150620 4:141376321-141376343 CAAACAAGGGAGCAGGCTGGAGG + Intergenic
981300837 4:143184808-143184830 GGAACAAGGGAGAAGGAGAGAGG + Intergenic
981379523 4:144056906-144056928 CAGAGAGAGGAGAAGGAGTGAGG + Intergenic
981530433 4:145747814-145747836 AAAACAAGAAAGAAGGAGGGAGG - Intronic
981902206 4:149879850-149879872 CAAACAAATAAGAAGGAGAAGGG + Intergenic
982216211 4:153084689-153084711 CAACCAAATGAGAAGGAGCAGGG - Intergenic
982549825 4:156783838-156783860 AAAACAAATGAAAAGAAGGGTGG + Intronic
982792131 4:159605374-159605396 TAAAAAAAAGAGAAGTAGGGTGG + Intergenic
982972425 4:162005873-162005895 TAAACAAAGGAGTAGGAAAGTGG - Intronic
983461077 4:168026746-168026768 GAAGCACAGGAGAAGGACGGAGG - Intergenic
983708863 4:170690060-170690082 CAAACAAAGGAGCAATAGGCAGG - Intergenic
983953950 4:173675333-173675355 AAAAGAAAAGAAAAGGAGGGAGG - Intergenic
984510532 4:180673402-180673424 TCAACAAAGGAGGAGGAGTGGGG + Intergenic
984607668 4:181804099-181804121 GGAAGGAAGGAGAAGGAGGGAGG + Intergenic
984791276 4:183617181-183617203 AAAAGAAAGAGGAAGGAGGGAGG - Intergenic
985279564 4:188271794-188271816 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
985583751 5:715362-715384 CACACAAAGGAAATGGTGGGAGG + Intronic
985597259 5:799659-799681 CACACAAAGGAAATGGTGGGAGG + Intronic
986009681 5:3700900-3700922 GAAAAGAAGAAGAAGGAGGGAGG - Intergenic
986183053 5:5411550-5411572 AAAAAAAAGAAGAAGGAGTGAGG - Intergenic
986294396 5:6424927-6424949 GGAAGAAAGGAGAAGGAAGGAGG - Intergenic
986537151 5:8801530-8801552 GAAAGAAAGAAGAGGGAGGGAGG + Intergenic
986568271 5:9137449-9137471 CAAGCAAAGGTAAATGAGGGAGG + Intronic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987849632 5:23333736-23333758 AAAACAAAGGAGAAAGAGGAAGG - Intergenic
988404625 5:30808245-30808267 GAAAGAAAGGAGAAGGAAGTAGG + Intergenic
988985555 5:36615110-36615132 GATACAAATCAGAAGGAGGGTGG - Intronic
989079707 5:37605009-37605031 AAAAAAAAAAAGAAGGAGGGGGG - Intronic
989311910 5:40028979-40029001 GAAGAAAAGGAGAAGGAGAGGGG - Intergenic
989338464 5:40347957-40347979 CAAACTAGAGACAAGGAGGGCGG + Intergenic
989509825 5:42272830-42272852 CAAACAAACAAAAAGCAGGGTGG + Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989553577 5:42764384-42764406 AAAACAGAGGAGGAGGAGGAGGG + Intronic
989555174 5:42786144-42786166 CAAAAAATTGAGGAGGAGGGAGG - Intronic
989791111 5:45402885-45402907 GAAAGAAAAGAAAAGGAGGGAGG - Intronic
990410780 5:55538681-55538703 CAAACAAAAGCAAAGTAGGGTGG + Intergenic
990496323 5:56351645-56351667 CAAACTAAAGACAAGGAAGGGGG + Intergenic
990569686 5:57065711-57065733 AAAGAAAAGGAGGAGGAGGGAGG - Intergenic
990779012 5:59337107-59337129 CAAAAAGAGGAGAAGGATGAAGG + Intronic
993054602 5:82967929-82967951 CAAGCAAAGACCAAGGAGGGAGG + Intergenic
993579796 5:89646155-89646177 CAAAATAAAGTGAAGGAGGGGGG - Intergenic
993634687 5:90329749-90329771 CACACAAAGGAGAAAGAGAAAGG - Intergenic
994038113 5:95225817-95225839 CAAACAAAAGGGAGGGAGGAAGG - Intronic
995023981 5:107398014-107398036 AAAACAAAGGAGAATAAGGTTGG - Intronic
995528070 5:113066685-113066707 CAGACAAAGGGGGAGGAGCGGGG + Intronic
996156319 5:120107175-120107197 GAAAAGAAAGAGAAGGAGGGAGG - Intergenic
996731277 5:126719781-126719803 CAAACCCAGGAGACGGAGGTTGG + Intergenic
996996690 5:129705229-129705251 CAATAAAAGGGGAAGGAGAGAGG - Intronic
997184091 5:131864299-131864321 CACACAAAGGAGGAGGAGAAAGG - Intronic
997245347 5:132343507-132343529 CAAGCAAAGGATAGAGAGGGAGG - Intronic
997439234 5:133897566-133897588 CAAGCCAAGGATAAGGAGGCAGG + Intergenic
997475066 5:134138036-134138058 CTGAAAAATGAGAAGGAGGGTGG - Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
997706972 5:135964827-135964849 GAAACACAGGAGGAGGAGAGAGG - Intergenic
998019461 5:138757195-138757217 CAAACAAAAGAAAAAAAGGGAGG + Intronic
998359633 5:141573803-141573825 CAGGCAAAGGAGGAGGTGGGGGG + Exonic
998771935 5:145555747-145555769 CAAGAAAAAGAGAAGGATGGAGG + Intronic
998961031 5:147487221-147487243 CAAAGACAGGAGAAAGGGGGAGG - Intronic
999041495 5:148418272-148418294 CAAGCAAAGGAAAATGAGGTAGG - Intronic
999128082 5:149261395-149261417 CTAACAAAGAAGAAGGAAGCAGG + Intergenic
999355879 5:150930132-150930154 CAAACAAGGGGGAGGGAGGATGG - Intergenic
999567097 5:152876519-152876541 CAATCAAATGAAAAAGAGGGTGG + Intergenic
999822073 5:155238396-155238418 CATTCAAAGCAGAAGTAGGGAGG - Intergenic
999863094 5:155669400-155669422 GAGACAAAGCAGAAGGAGAGGGG + Intergenic
999993432 5:157069390-157069412 CAAACAGACCAGGAGGAGGGAGG - Intergenic
1000625168 5:163529942-163529964 AAAAAAAAGGAGGGGGAGGGAGG + Intergenic
1000865158 5:166504606-166504628 AAAAGAAAGGAGAAGGAGATTGG - Intergenic
1001079410 5:168656112-168656134 AATAAAAAGGAGGAGGAGGGAGG - Intergenic
1001092051 5:168748755-168748777 GAAAGAAAGGAGAAAGAGGAAGG - Intronic
1001144366 5:169170827-169170849 CAAAAAAGGGAGAACAAGGGTGG + Intronic
1001185529 5:169567860-169567882 AAAAAAAAGGAGAAGAAGAGAGG - Intergenic
1001897048 5:175391497-175391519 CAAACAAACAAAAAGGTGGGGGG - Intergenic
1002107323 5:176886630-176886652 CAAAGAAAGGAGGAGGAGAGAGG + Intronic
1002669746 5:180856980-180857002 CAAATACAGGACATGGAGGGTGG + Intronic
1003012047 6:2435458-2435480 GAAATAAAGAAGAAGGAAGGAGG - Intergenic
1003089202 6:3087320-3087342 GAAAGAAAAGAGAAAGAGGGTGG - Intronic
1003327454 6:5103231-5103253 CAAACACAGAAGAAGCGGGGAGG + Intronic
1003363509 6:5450931-5450953 CAAACAAAGCAGAAGATGAGGGG - Intronic
1003376236 6:5580298-5580320 AAAAAAAAAGAGAAGGAGGGAGG + Intronic
1003679714 6:8240430-8240452 AAAAAAAAGAAGAAGAAGGGAGG - Intergenic
1004155069 6:13160178-13160200 CAAACAAAAGACAAACAGGGAGG - Intronic
1004331861 6:14728982-14729004 GAAAAAAATGGGAAGGAGGGAGG + Intergenic
1004873878 6:19935782-19935804 CAAATAAAGGAGAAAGAGTGTGG - Intergenic
1005061840 6:21783797-21783819 GCAAAAAAGGAGAAGGAGGAAGG - Intergenic
1005064844 6:21808025-21808047 GAAACACTGGGGAAGGAGGGTGG + Intergenic
1005159222 6:22838835-22838857 CATACAAAGGAGGAAGAGGCAGG + Intergenic
1005219455 6:23570268-23570290 AAACCAAAAGAGAAGGAGGTAGG + Intergenic
1005248792 6:23919952-23919974 CAAACAAAAAAGAATGAGTGTGG - Intergenic
1005425173 6:25695381-25695403 CAAAAAAAGGTGGAGGGGGGTGG - Intronic
1006189478 6:32198810-32198832 CAAAGATAGGGGAAGGAGAGAGG - Intronic
1006912963 6:37576000-37576022 CAGACAAAGAAGAAGGAGTGTGG - Intergenic
1007718475 6:43870707-43870729 AAAAGGAAGGAGAAGGAGAGGGG - Intergenic
1007725208 6:43911850-43911872 TGAACAAAGGCGGAGGAGGGAGG - Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007992119 6:46267522-46267544 CAAACAAACGAAAACGAGGTGGG + Intronic
1008016417 6:46525568-46525590 AGAAGAGAGGAGAAGGAGGGAGG + Intergenic
1008055949 6:46946224-46946246 CAGCCAGAGAAGAAGGAGGGAGG + Intronic
1008475522 6:51931847-51931869 AGAATAAAGGAGAGGGAGGGAGG + Intronic
1008704029 6:54136757-54136779 GAAACAAAGGAGAAAGCAGGTGG - Exonic
1010050229 6:71495408-71495430 CAAAGAATGGGGAAGGAAGGTGG + Intergenic
1010654081 6:78491021-78491043 CAAGAAAAGGAGAATGAGAGAGG + Intergenic
1010786179 6:80004249-80004271 GAAACGAAGGAGAAGGGTGGCGG + Intronic
1012053624 6:94375653-94375675 CAAAAAAGGTTGAAGGAGGGTGG + Intergenic
1012875542 6:104721343-104721365 CAAACAAAAGGGGAGGAGAGGGG + Intergenic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013364278 6:109424083-109424105 CAAGGTAAGGAGTAGGAGGGTGG + Intronic
1013527757 6:110990568-110990590 CAAACAAAAGAAAAGGTGGGGGG - Intronic
1013673977 6:112436478-112436500 CACCCAAAGGAGGAGGAGAGGGG + Intergenic
1013840476 6:114386641-114386663 CAAAGAGAGGAAAAGGAGGGAGG + Intergenic
1014224244 6:118829872-118829894 CAAAAAAGAGAGAAAGAGGGAGG + Intronic
1015170387 6:130245897-130245919 CGAACATAGGAGAAGGTAGGAGG + Intronic
1015234114 6:130951255-130951277 AAAAAAAAGGAGGGGGAGGGGGG + Intronic
1015532270 6:134232496-134232518 AAAAGAAAGAAGAGGGAGGGAGG + Intronic
1015567431 6:134588011-134588033 GAAAGAAAAGAAAAGGAGGGAGG + Intergenic
1015839103 6:137457118-137457140 CAAACAAGGGAGAACAAGAGTGG + Intergenic
1016454244 6:144215071-144215093 CATACAATGGAGATGGCGGGTGG + Intergenic
1016709396 6:147152840-147152862 CAAACAAAGGAGAAGAGGGCAGG - Intergenic
1016811468 6:148265306-148265328 CCAAGAAAGAAAAAGGAGGGAGG + Intergenic
1017296161 6:152797068-152797090 CAAATATAGTAGAAGGAGGGAGG - Intergenic
1017516070 6:155156774-155156796 CAAAGAAAGGAGCAGAAGGGTGG - Intronic
1017551725 6:155516930-155516952 CAAATGAGGGAGAAGGTGGGTGG + Intergenic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1017757974 6:157545682-157545704 AAAAAAAAGTAGAAGGAGGGTGG + Intronic
1017804198 6:157929209-157929231 CAAACAAAGGAGAAGGAGGGAGG - Intronic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018268968 6:162055582-162055604 CACAGAAAGGAGGAGGAGGGAGG + Intronic
1019253760 7:35372-35394 CAAACAAAAAAGAAGGAAGACGG - Intergenic
1019266811 7:121693-121715 GGAGAAAAGGAGAAGGAGGGAGG + Intergenic
1019494974 7:1333475-1333497 TAAAAAAAGGAGAAGAAGGAGGG - Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019873352 7:3788104-3788126 CAATCGAAGCAGAAGGAGTGAGG - Intronic
1019916819 7:4138767-4138789 GAAAGAAAGAAGAAGGAAGGAGG + Intronic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020240406 7:6390042-6390064 AAAAGAAAGGAGAAGGAAGGAGG - Intronic
1020853341 7:13385283-13385305 AAAACAAAAGAGATGGAGGAAGG + Intergenic
1020865799 7:13560712-13560734 CAGACAAAGGAAAAGAAGGAAGG + Intergenic
1020914876 7:14180363-14180385 GAAAAAAATCAGAAGGAGGGTGG - Intronic
1021197294 7:17687849-17687871 TAAACAAAGGAAAAGGAGTTTGG + Intergenic
1021599878 7:22354960-22354982 CCATCAAAGGAGTAGGAAGGGGG - Intronic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022673734 7:32479155-32479177 CACACACAGGAGAAGAAGGGAGG - Intergenic
1022803569 7:33799162-33799184 CAAACATAAGAGAAAGAGGATGG - Intergenic
1022834079 7:34097178-34097200 CAAAAAGAGGAGCAGGAGGCTGG + Intronic
1023348212 7:39293209-39293231 CATGCCAAGGAGAGGGAGGGTGG - Intronic
1023734624 7:43223919-43223941 CAATCAAAGGAGAGAGAAGGTGG - Intronic
1025002233 7:55326000-55326022 GAAACAAAGTGAAAGGAGGGTGG + Intergenic
1026157868 7:67843060-67843082 AGGACAAAGGAGAAGGAGAGAGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1026582839 7:71632423-71632445 CAAAGAAAGGAGAAGGCAGTAGG + Intronic
1026889983 7:73976172-73976194 CAACCATAGCTGAAGGAGGGAGG - Intergenic
1026890886 7:73981542-73981564 GAAAGGAAGGAGAGGGAGGGAGG + Intergenic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027397180 7:77767849-77767871 GAATGAAAGGAGAGGGAGGGGGG - Intronic
1027505229 7:79009006-79009028 AAAAAAAAGGAGAAGGAAGAGGG - Intronic
1027798043 7:82718399-82718421 TAAACAAAGGAAAAGGAGTATGG - Intergenic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028134274 7:87209984-87210006 GAGACAGAGGAGAGGGAGGGGGG + Intronic
1028136438 7:87227790-87227812 GAAAGAAAGAAGAGGGAGGGAGG + Intergenic
1028311003 7:89335720-89335742 CAAACACTGCAGAAGGAGAGAGG + Exonic
1028409972 7:90519848-90519870 CAAACAAAGAAGAATGAAGGAGG - Intronic
1028430393 7:90740157-90740179 GAAACGGAGGAGAAGAAGGGAGG - Intronic
1028601003 7:92600395-92600417 CAATCCAAGGAGCAGGAGGGAGG + Intergenic
1028639344 7:93025939-93025961 GAAAAAAAGGAGAAGAAGGGTGG + Intergenic
1029072541 7:97911755-97911777 CACACAAGGAATAAGGAGGGAGG + Intergenic
1029191166 7:98773257-98773279 CCAGCACAGGAGAACGAGGGAGG + Intergenic
1029264820 7:99330297-99330319 CAAACAAACAAAAAGGGGGGGGG - Intronic
1029486547 7:100846223-100846245 CAAACAAAGGAGCAGTAAGCAGG - Intronic
1029872226 7:103706969-103706991 TAAACAAATGAGCAGGAGGAGGG - Intronic
1029923170 7:104287615-104287637 AAAAGAAAAGAGAAGAAGGGAGG - Intergenic
1030142018 7:106314434-106314456 CAATTAAAGGACAAGGAGAGTGG - Intergenic
1030174425 7:106636579-106636601 GAAAGAAAAGGGAAGGAGGGAGG + Intergenic
1030344340 7:108415583-108415605 CATAAAAAGGAGAAGAAGGCCGG + Intronic
1030611006 7:111688766-111688788 CAAACAAACGAAAAGGACAGAGG - Intergenic
1031065543 7:117101097-117101119 CAAACAGAGGAGAGGGATGATGG + Intronic
1032059671 7:128714193-128714215 CACACAAAGGACAAGCATGGAGG - Intronic
1032131642 7:129233996-129234018 AAAAGAAAGGAGGAGGAAGGGGG - Intronic
1032182673 7:129694194-129694216 CAAACAAATGAGGAGGAAGAGGG + Intronic
1032601378 7:133299863-133299885 CAAAGAGAGGAGAAGGACTGAGG - Intronic
1032869959 7:135974540-135974562 CAAAAAAAAGAGGAGGAGGAGGG + Intronic
1032923980 7:136580705-136580727 GAAACAAAGAAGAAGGGGGAAGG - Intergenic
1032962037 7:137046853-137046875 TAAACACAGAAGAAGGAGGAGGG + Intergenic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033192105 7:139290739-139290761 CAAATAAAGGAGAACAGGGGAGG + Intronic
1033821627 7:145141361-145141383 CCAAAAAAGGAGATGGAGGTGGG - Intergenic
1034054982 7:148024829-148024851 CAAAGAAAGGAGAAGGCAGGGGG - Intronic
1035136249 7:156705785-156705807 CACACAAAGGAGAAAGAGAAGGG + Intronic
1036191435 8:6674299-6674321 CACACAAGGGAGATGGAAGGAGG - Intergenic
1036245125 8:7109547-7109569 CACACAAGGAATAAGGAGGGAGG - Intergenic
1036255624 8:7204262-7204284 CACACAAGGAATAAGGAGGGAGG + Intergenic
1036361861 8:8083240-8083262 CACACAAGGAATAAGGAGGGAGG - Intergenic
1036792680 8:11732485-11732507 AAAACAAAACAGAAGGAGAGAGG + Intronic
1036889106 8:12583775-12583797 CACACAAGGAATAAGGAGGGAGG + Intergenic
1036975389 8:13405291-13405313 CACAGAGGGGAGAAGGAGGGAGG - Intronic
1037169435 8:15873957-15873979 GGAAGGAAGGAGAAGGAGGGAGG - Intergenic
1037233310 8:16686542-16686564 CAAGCAAAGAAGAAGGATGGTGG + Intergenic
1037499481 8:19471353-19471375 GAAAAAAAAGAAAAGGAGGGAGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038038962 8:23707890-23707912 GAAAGAAAGAAAAAGGAGGGAGG - Intergenic
1039161299 8:34624760-34624782 CAAAAACAGGAGCAAGAGGGTGG + Intergenic
1039231597 8:35454640-35454662 TAAACAAAGGAAAAAGAGTGTGG - Intronic
1039583763 8:38688068-38688090 GAAAGAAAGGAGAAGAAGGGAGG + Intergenic
1039848775 8:41344593-41344615 GAAAGAAAGGAGAAGAAGAGAGG - Intergenic
1040491891 8:47931302-47931324 CCAACAAGGGAGGAGGAGGCTGG + Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041093087 8:54321989-54322011 CTAACTAAAAAGAAGGAGGGAGG + Intergenic
1041396769 8:57399593-57399615 AGAAAAAAAGAGAAGGAGGGAGG - Intergenic
1041535802 8:58924339-58924361 CATACTAAGCAGAAGTAGGGAGG + Intronic
1041633573 8:60116613-60116635 ATAAAAAAGGAGAATGAGGGTGG - Intergenic
1042215111 8:66423424-66423446 GAAAGAAAGAAAAAGGAGGGGGG - Intergenic
1042228756 8:66536387-66536409 GACACAAAGGAGAAGGCAGGTGG + Intergenic
1042338968 8:67658890-67658912 CAGACAAAAGAGAATGAGAGAGG - Intronic
1042691297 8:71502306-71502328 CAGACAAAGAAGAATGAGAGGGG - Intronic
1042777344 8:72448075-72448097 CACATACAGGAGAAGGAAGGCGG + Intergenic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043001306 8:74763467-74763489 CAAGAAAAGGAGAAGGAAAGGGG - Intronic
1043772468 8:84222777-84222799 CAAGCAGAGGTGAAGGAGTGGGG + Intronic
1044401830 8:91781657-91781679 CAGGCAGAGGAGATGGAGGGGGG - Intergenic
1044595927 8:93958319-93958341 AAAACCACAGAGAAGGAGGGAGG - Intergenic
1044656645 8:94555275-94555297 TAAACACAGAAGAAGGGGGGGGG - Intergenic
1045522958 8:102919363-102919385 GAAACAAATCAGAAGGAAGGGGG - Intronic
1045975604 8:108127846-108127868 AAAACAAAAAAGAAGGAGGAAGG + Intergenic
1046058545 8:109108259-109108281 CAAATGATGGAGAAGGAGAGAGG - Intronic
1046106272 8:109670852-109670874 GAAACAAGAGGGAAGGAGGGAGG + Intronic
1046205054 8:110983294-110983316 CAAACAAACAAGAATGAGGGAGG - Intergenic
1046412944 8:113872416-113872438 AAAAGAAAAGAGAAGGAGTGGGG - Intergenic
1046738984 8:117808902-117808924 AAAACAAAGGTGAAGGAAGGAGG + Intronic
1047458784 8:125041640-125041662 AAAAAAAAAGAAAAGGAGGGTGG + Intronic
1047486503 8:125335576-125335598 CAAACAAAGGAGCAAAATGGGGG + Intronic
1047679464 8:127239527-127239549 GAACCAAAGGAGAAGGAAAGAGG + Intergenic
1047806067 8:128361175-128361197 GAAAGAAAAGAAAAGGAGGGAGG - Intergenic
1048085819 8:131178332-131178354 TAAAAAAAGTAGAAGGAGGCTGG + Intergenic
1048392621 8:133982064-133982086 GAAACAAAGGAGCAGAAGGGAGG - Intergenic
1048520677 8:135151471-135151493 TAAAGGAAAGAGAAGGAGGGAGG + Intergenic
1049429581 8:142553915-142553937 AACACAAAGAAGAAGGAAGGAGG - Intergenic
1049594849 8:143478497-143478519 CAAAAAAATAAGAAGGAGCGGGG - Intronic
1050243186 9:3659375-3659397 CAAACCAAGGAGATGGACTGTGG - Intergenic
1050314858 9:4391019-4391041 CAAACAGAGGAGAAGACAGGAGG - Intergenic
1050506272 9:6352595-6352617 CATATAATGGATAAGGAGGGTGG - Intergenic
1050690396 9:8221166-8221188 AAGACTAAGGAGAAGCAGGGTGG + Intergenic
1050914167 9:11110148-11110170 GAAACAAAAGAAAAAGAGGGGGG + Intergenic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1051350302 9:16192474-16192496 AAGAGATAGGAGAAGGAGGGAGG - Intergenic
1052869973 9:33495150-33495172 AAAAAAAAGGAAAAGAAGGGAGG + Intergenic
1053485010 9:38445794-38445816 CAAAAAAAGCAGAAGGATGTGGG + Intergenic
1053752120 9:41267249-41267271 CAAACAAAAAACAAAGAGGGAGG - Intergenic
1054140311 9:61523178-61523200 GGAAGGAAGGAGAAGGAGGGAGG + Intergenic
1054257644 9:62831581-62831603 CAAACAAAAAACAAAGAGGGAGG - Intergenic
1054333675 9:63784142-63784164 CAAACAAAAAACAAAGAGGGAGG + Intergenic
1055250860 9:74303770-74303792 CAAACAATGCAGAAGGTAGGAGG + Intergenic
1055359325 9:75472568-75472590 GAAACAAAGGAGAGAGAGGGTGG + Intergenic
1056072802 9:83006583-83006605 AAAAGAAAGGGGAAGGAGAGGGG + Intronic
1056320481 9:85430420-85430442 AAAAGAAATGAGAAGAAGGGAGG + Intergenic
1056554455 9:87677158-87677180 CAATAAATGGAGAAGGAGGGAGG - Intronic
1056638046 9:88347641-88347663 CATACAAAGGAGAAATAAGGAGG + Intergenic
1056719082 9:89058189-89058211 AAAACAAAGAAGATGGAGGATGG + Intronic
1056770383 9:89474140-89474162 CAACCAAAGGGGGAGGTGGGAGG - Intronic
1057688422 9:97259929-97259951 CCAGCAAAGGAAAAGAAGGGAGG - Intergenic
1057803869 9:98206988-98207010 CAAACAAATGAGAAGTACAGGGG + Intronic
1057958553 9:99432945-99432967 CACCCAAAGCAGAAGGGGGGTGG - Intergenic
1058057254 9:100461708-100461730 AAAACAAAAGATAAGGAGAGAGG - Intronic
1058211471 9:102174642-102174664 AAAAGAATGGATAAGGAGGGTGG - Intergenic
1058457206 9:105148668-105148690 GAAAGAAAGGAGGAGGAGGCAGG + Intergenic
1058579320 9:106437642-106437664 GAAAGAAAGAAGAAGAAGGGGGG - Intergenic
1059098024 9:111439894-111439916 CACAGCAAGGAGAAGGAAGGAGG + Intronic
1059553176 9:115250883-115250905 CAAACACAGGGGAAGGAATGTGG + Intronic
1060124270 9:121026935-121026957 AATACAAAGGGGAGGGAGGGAGG + Intronic
1060330943 9:122669688-122669710 AAAACAAAGGACAAGGAAGTTGG + Intergenic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1060515222 9:124261384-124261406 CAAGCAAGGGAGTTGGAGGGTGG + Intronic
1060722498 9:125988463-125988485 TAAAGAAATGAGAAGCAGGGAGG - Intergenic
1060879967 9:127111195-127111217 CAAACAACGAAGAAGGGGGCAGG - Intronic
1060948888 9:127588078-127588100 TGAACAAAGGGGAGGGAGGGAGG - Intergenic
1061942579 9:133891493-133891515 CAGATAGAGGAGAAGGATGGAGG + Intronic
1061948501 9:133922100-133922122 CAAACAAAGCAGAGGGAGCCGGG - Intronic
1062261430 9:135665040-135665062 CAAGCCAATGACAAGGAGGGAGG + Intronic
1062483857 9:136764626-136764648 CAAACAATGGACAAGGGGGCCGG - Intronic
1062527890 9:136985616-136985638 CAAAACAAGGAGCAGGTGGGCGG - Exonic
1062638350 9:137503380-137503402 CCAAAAAAGAAGAAGGAAGGAGG + Intronic
1062682683 9:137790519-137790541 CAGACAAAGAAGGGGGAGGGAGG - Intronic
1062746636 9:138217171-138217193 CAAACAAAAAAGAAGGAAGACGG + Intergenic
1202801119 9_KI270719v1_random:176755-176777 CAAACAAAAAACAAAGAGGGAGG + Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185814305 X:3140323-3140345 CAAACACAAGAGGAGTAGGGTGG + Intergenic
1186206365 X:7204839-7204861 CAAGCAAAGAGGAAGGAAGGAGG - Intergenic
1186430087 X:9497805-9497827 GAAAGAAACGAGAGGGAGGGAGG - Intronic
1186679129 X:11853837-11853859 CAAACAATTGAGGAGGAGGAGGG + Intergenic
1186843124 X:13505225-13505247 GAAAGAAAAGAAAAGGAGGGTGG + Intergenic
1186957152 X:14696157-14696179 CCAAGAAAGGAGAAGAAGGGAGG + Intronic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187896930 X:23990772-23990794 GAAAGAGAGGAGAAGGAAGGGGG - Intronic
1187992072 X:24885528-24885550 AAAAAAAGAGAGAAGGAGGGAGG - Intronic
1188043181 X:25394336-25394358 GAAAGAAAGGAGATAGAGGGAGG - Intergenic
1188120915 X:26306047-26306069 CAAGCAAGAGAGAAGGAGAGAGG + Intergenic
1188390655 X:29615393-29615415 AAAACAAAGGAGAGGAGGGGAGG + Intronic
1188697084 X:33207107-33207129 CAGACAAATGAGAATGAGGAAGG - Intronic
1188839190 X:34994209-34994231 AAAAGAAAGGAGAAAGAAGGTGG - Intergenic
1189043803 X:37570818-37570840 CAAACATGGGAAAAGAAGGGAGG + Intronic
1189120820 X:38392869-38392891 TAAACAAAGGACAAAGAGTGCGG - Intronic
1189314010 X:40040907-40040929 TAAAAGAAGGAGAAGGAGGAGGG - Intergenic
1189322140 X:40093393-40093415 TAAAGAAAGGAAGAGGAGGGAGG + Intronic
1189582736 X:42424764-42424786 CAATCAGAGGCAAAGGAGGGTGG + Intergenic
1189649260 X:43171686-43171708 CACACAAAGGAAGAGGTGGGTGG - Intergenic
1190469991 X:50769212-50769234 GGAAGAAAGGGGAAGGAGGGAGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1192533642 X:71910791-71910813 AAAAGAGAGGAGGAGGAGGGGGG + Intergenic
1193085271 X:77443314-77443336 CAAAGAAAACAGAAGGAGAGAGG + Intergenic
1193203947 X:78725843-78725865 GAAAGAAAAGAGAGGGAGGGAGG - Intergenic
1193431888 X:81417635-81417657 CAAAGCAAGGAGAAGGATAGGGG - Intergenic
1193819981 X:86149173-86149195 CAAACAAAGTTGGATGAGGGTGG - Intronic
1194027197 X:88767082-88767104 AAAACAAAAGAGAAAGAGAGAGG + Intergenic
1194209014 X:91046382-91046404 AAAAGACAGGAGAAGCAGGGAGG + Intergenic
1194642033 X:96413673-96413695 CCATCAAAGGGGACGGAGGGGGG + Intergenic
1194668625 X:96703918-96703940 AAAAGAAAAGAAAAGGAGGGAGG - Intronic
1194793521 X:98181186-98181208 AAAAGAAAGGAGGAGGATGGAGG - Intergenic
1194903231 X:99541263-99541285 AAACCAAAAGAGAATGAGGGTGG + Intergenic
1195025060 X:100868512-100868534 CAAAAACAGAAGAGGGAGGGAGG - Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1196484084 X:116183893-116183915 CACAGAAAGGAGAAGGAGAAAGG + Intergenic
1197192944 X:123669160-123669182 CAAAAAAAAAAAAAGGAGGGAGG + Intronic
1197308284 X:124871148-124871170 CAAACAGGGGAGGAGGAAGGGGG - Intronic
1197559826 X:128005794-128005816 CATTCAATGGAGAAGGAGAGTGG - Intergenic
1197700741 X:129597741-129597763 GCAAGAAAGAAGAAGGAGGGAGG + Intergenic
1197961979 X:132017031-132017053 AAAAAAAAGAAGAAGAAGGGAGG + Intergenic
1197976304 X:132169219-132169241 CACACACAGGAGAAGATGGGGGG - Intergenic
1198080132 X:133231865-133231887 AAAAAAAAAGAGAAGGAGGGAGG + Intergenic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1200478539 Y:3672352-3672374 CAAACAATGGACAAGCAGAGAGG - Intergenic
1201319251 Y:12679346-12679368 CAATCAAATGAGAATGGGGGAGG - Intergenic
1201553539 Y:15244275-15244297 GAAAAAAAAGAGAAAGAGGGTGG + Intergenic