ID: 1017804765

View in Genome Browser
Species Human (GRCh38)
Location 6:157934940-157934962
Sequence CAATTGGAAGAGCCTACCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017804758_1017804765 20 Left 1017804758 6:157934897-157934919 CCCACCACAGTGAACCAGGGTTC 0: 1
1: 0
2: 8
3: 106
4: 899
Right 1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1017804762_1017804765 -2 Left 1017804762 6:157934919-157934941 CCTATCAAAAGACTTAGATACCA 0: 1
1: 0
2: 0
3: 25
4: 342
Right 1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1017804760_1017804765 16 Left 1017804760 6:157934901-157934923 CCACAGTGAACCAGGGTTCCTAT 0: 1
1: 0
2: 0
3: 24
4: 205
Right 1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1017804755_1017804765 26 Left 1017804755 6:157934891-157934913 CCACGTCCCACCACAGTGAACCA 0: 1
1: 0
2: 1
3: 15
4: 120
Right 1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1017804761_1017804765 6 Left 1017804761 6:157934911-157934933 CCAGGGTTCCTATCAAAAGACTT 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 112
1017804759_1017804765 19 Left 1017804759 6:157934898-157934920 CCACCACAGTGAACCAGGGTTCC 0: 1
1: 0
2: 4
3: 32
4: 224
Right 1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG 0: 1
1: 0
2: 0
3: 10
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017804765 Original CRISPR CAATTGGAAGAGCCTACCAC TGG Intronic
904352320 1:29916614-29916636 CAAGTAGAAGAGCCCAGCACAGG + Intergenic
906247969 1:44290364-44290386 CAGTTGGAAGATCCTGCCACAGG + Intronic
919573167 1:199274057-199274079 CTATTGTAAGACCCCACCACAGG + Intergenic
920396574 1:205650571-205650593 CAACTTGAAGAGGCTCCCACTGG + Intergenic
921139131 1:212288702-212288724 CAAATGGAAAAAACTACCACTGG - Intronic
923873570 1:238022447-238022469 CACTTGGAAAAGCCTTCCACAGG - Intergenic
1064160610 10:12942510-12942532 CAATAGGAAGAGGCTACCTGGGG + Intronic
1064667649 10:17673093-17673115 CACTTAGAAGAGTCTACCAAAGG - Intronic
1069986959 10:72291082-72291104 TAGTGGGAAGAGCCCACCACAGG - Intergenic
1070860448 10:79653928-79653950 CAATGGAAAGACCCTCCCACAGG + Intergenic
1070876814 10:79821626-79821648 CAATGGAAAGACCCTCCCACAGG - Intergenic
1084431417 11:69113533-69113555 CATTTGGAAGTGCCCACCAGAGG - Intergenic
1086554544 11:88093370-88093392 CAATTGGAAGTGACTACTAATGG + Intergenic
1093436425 12:19140018-19140040 TAATTGGAAGACCTTGCCACTGG - Intronic
1093827871 12:23716971-23716993 GACTTGGAAGAGCCAAGCACAGG - Intronic
1096040420 12:48510447-48510469 CCATTGGAAGGTACTACCACAGG + Intronic
1096534603 12:52263347-52263369 CAAGTGGAAGAGACTTCCAGGGG - Intronic
1106564912 13:30875702-30875724 CAAATGGAAGAGCCACACACAGG - Intergenic
1106909239 13:34445593-34445615 CAATTGGAAAGGCCTTACACAGG + Intergenic
1111530197 13:89526576-89526598 CAATAGGAAAAGGCTACCTCAGG - Intergenic
1118878691 14:69808069-69808091 CCCTTGGAAGTGCCTGCCACTGG + Intergenic
1119124009 14:72107341-72107363 CAAGTTGAAGAGGCTCCCACTGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1132589435 16:720267-720289 CAAGTGGAAGAGCCGAGCTCTGG - Intronic
1134003593 16:10802156-10802178 CAACTGGAAGAGGCTCCTACTGG + Intronic
1134910120 16:18018242-18018264 CAATTGGAATTCCATACCACCGG + Intergenic
1140561954 16:75993885-75993907 CAAATTGAAGAGTTTACCACTGG - Intergenic
1144603035 17:16636084-16636106 CAACTTGAAGAGGCTTCCACTGG + Intronic
1146677913 17:34786083-34786105 CCAGTGGAAGAGCCTCCCAGAGG - Intergenic
1150935479 17:69630818-69630840 CAACTCGAAGGGGCTACCACTGG + Intergenic
1151220128 17:72605988-72606010 CTATGGGAAGAGCCCCCCACTGG + Intergenic
1151220206 17:72606265-72606287 CTATGGGAAGAGCCTCCCATTGG + Intergenic
1152811718 17:82385636-82385658 CCTTTGGCAGAGCCCACCACTGG + Intergenic
1155400343 18:25432131-25432153 CAATTTGAAGAAACTACCAATGG + Intergenic
1155647045 18:28091640-28091662 CTATTTGAAGAAGCTACCACTGG + Intronic
1156209775 18:34926968-34926990 CAGTTGGAAAAGTCTATCACTGG + Intergenic
1157935410 18:51866627-51866649 CAAGTAGAAGAGACTACCAATGG - Intergenic
1164820471 19:31246911-31246933 CAATTTGCAGAGACTCCCACTGG + Intergenic
1166808284 19:45499773-45499795 CAATTGGGAGCGCCTAGGACCGG + Intronic
925972438 2:9115427-9115449 CAATAGAAAGAGCCACCCACTGG + Intergenic
927107242 2:19838638-19838660 CAATTTGAAGAGGCTTCTACTGG - Intergenic
931549033 2:63422278-63422300 CAACCTGAAGAGCCTCCCACTGG + Intronic
932166920 2:69516672-69516694 CAATTTGAAGAGACTTCCACTGG + Intronic
932369090 2:71172905-71172927 CCAGTGGAACTGCCTACCACAGG + Intergenic
933318421 2:80742465-80742487 AAAGGGGAAGAGCCTGCCACTGG - Intergenic
933357281 2:81227915-81227937 CAAATCGAAGAGTCTGCCACTGG + Intergenic
933446079 2:82381174-82381196 TAATAGGTAGTGCCTACCACAGG + Intergenic
933631147 2:84660273-84660295 CAGTTTGAAGAGACTTCCACTGG + Intronic
935669864 2:105545876-105545898 CAGGTGGAAGAGCCTGCCAGTGG + Intergenic
939409287 2:141803332-141803354 GAATTGAAAGGGCCTAACACTGG - Intronic
939610037 2:144298848-144298870 CAATTGGAGGAGTATACCATTGG - Intronic
942011342 2:171765613-171765635 TAATTGCAAGAGGCTCCCACTGG + Intergenic
942211868 2:173679145-173679167 CAATTTGAAGAAGCTCCCACTGG + Intergenic
942616225 2:177794495-177794517 CAATTCGATGAGCCTGCCTCTGG - Intronic
944941695 2:204635135-204635157 CAACTTGAAGAGGCTTCCACTGG - Intronic
1172260101 20:33556903-33556925 CAGTTAGAAGGGACTACCACTGG - Intronic
1173836331 20:46128556-46128578 CCACTGGCAGAGCCTAACACTGG + Intronic
1178969283 21:37157310-37157332 TAATGGGAAGAGCCTAGAACTGG + Intronic
1181167818 22:20992798-20992820 CGCGTGGAAGAGCCTCCCACTGG - Exonic
1182141948 22:27967189-27967211 CAATTTGAAGGGGCTCCCACTGG - Intergenic
1182408075 22:30155426-30155448 CAACTTGAAGAGGCTCCCACTGG - Intronic
950367710 3:12499807-12499829 CAATTGGAAGAACTGAACACAGG + Intronic
950601451 3:14039196-14039218 CAATTGCAAGAGCACACCAAGGG + Intronic
951849996 3:27128738-27128760 CAAATTGAAGAGGCTCCCACTGG - Intronic
952341566 3:32451713-32451735 CCATTTGATGAGCCTCCCACAGG + Intronic
953483529 3:43273254-43273276 CAAGTTGAAGGGCCTTCCACTGG - Intergenic
953579267 3:44138746-44138768 CAATTTAAAGGGCCTCCCACTGG - Intergenic
954827789 3:53390409-53390431 CATTTTGAAGAGCCTTCCACAGG + Intergenic
957134626 3:76270000-76270022 CAATTGGAAAAGGCTACTACTGG + Intronic
957302096 3:78405359-78405381 CTATTGGAAGAGTCTTCCATGGG + Intergenic
959078544 3:101777034-101777056 CAATTGGAGGAGGCTGCCAAGGG - Intergenic
962179572 3:133191804-133191826 CACTTGTAATAGCCTCCCACTGG - Intronic
962954380 3:140250678-140250700 CAATTGGATGAGCCTTCGCCAGG + Intronic
970149723 4:13076441-13076463 CAATTATAAGCCCCTACCACAGG + Intergenic
972744951 4:41923723-41923745 CAATAGGAGAAGCCTACCAGGGG + Intergenic
973805481 4:54522041-54522063 CAATTTAAAGAGGCTCCCACTGG + Intergenic
974858321 4:67487427-67487449 CAACTTGAAGATGCTACCACTGG - Intronic
974889395 4:67861646-67861668 AACTTGGATGAGCCTCCCACGGG + Intronic
976721734 4:88175684-88175706 CAATTTGAAGGGCCTTTCACTGG - Intronic
979455971 4:120926309-120926331 GAAGTTCAAGAGCCTACCACTGG - Intergenic
979987674 4:127335179-127335201 CAATTGGAACTGCCTAGCCCAGG + Intergenic
987064454 5:14274830-14274852 CAATTTGAAGAGGCTCCCATTGG - Intronic
987700025 5:21385663-21385685 CAATTGGAAGACCTTACAATAGG + Intergenic
988752382 5:34202426-34202448 CAATTGGAAGACCTTACAATAGG - Intergenic
990934684 5:61135391-61135413 CAACTGGAAGGGGCTCCCACTGG + Intronic
991740149 5:69663253-69663275 CAATTGGAAGACCTTACAATAGG - Intergenic
991757350 5:69889935-69889957 CAATTGGAAGACCTTACAATAGG + Intergenic
991791724 5:70242994-70243016 CAATTGGAAGACCTTACAATAGG - Intergenic
991819612 5:70539370-70539392 CAATTGGAAGACCTTACAATAGG - Intergenic
991836753 5:70765817-70765839 CAATTGGAAGACCTTACAATAGG + Intergenic
991884173 5:71243332-71243354 CAATTGGAAGACCTTACAATAGG - Intergenic
994262223 5:97673282-97673304 CAGTGAGAACAGCCTACCACAGG + Intergenic
994741892 5:103629403-103629425 CAATTGGAAGAGGGTTCCACTGG - Intergenic
995496769 5:112753707-112753729 CAATTGGAAGACTCTACCAAAGG - Intronic
999597926 5:153226073-153226095 CAATTTGAAGAGGCTCTCACTGG - Intergenic
1000445281 5:161311547-161311569 CAATTAGCAGTGCCTAACACAGG - Intronic
1005550551 6:26909150-26909172 CAATTGGAAGACCTTACAATAGG - Intergenic
1009311032 6:62152892-62152914 CAATTTGAAGAGCCTGTAACAGG - Intronic
1013835849 6:114334263-114334285 GAATTGGAAAAGCTTGCCACGGG - Intronic
1014265308 6:119270046-119270068 CAACTGGAAGAGGCTTCCATTGG - Intronic
1017804765 6:157934940-157934962 CAATTGGAAGAGCCTACCACTGG + Intronic
1023221788 7:37926968-37926990 CAATTTGAAGAGGCTTCCACTGG - Intronic
1029369981 7:100143565-100143587 CAACTTGAAGAGGCTTCCACTGG - Intergenic
1030778785 7:113571457-113571479 AAATTGGAAGAGTCAACCACAGG + Intergenic
1033594819 7:142850897-142850919 CTACTGGAAGAGCCGACCAGGGG + Intergenic
1037934931 8:22909167-22909189 CAATGGGAAGAGCCGACACCAGG - Intronic
1039490986 8:37947350-37947372 CAATCAGAAGAGACTTCCACAGG + Intergenic
1041285440 8:56256545-56256567 CAACTTGAAGAGGCTCCCACTGG - Intergenic
1042793410 8:72633667-72633689 CAATAGAAAGAGACTACCAAAGG - Intronic
1046010285 8:108538353-108538375 CAAGTGGAAGAGGCAAACACAGG - Intergenic
1048936705 8:139363574-139363596 CAAATGGAGCAGCCTAACACAGG + Intergenic
1051898861 9:22016944-22016966 CAATTTGCAGAGGCTCCCACTGG - Intronic
1052399242 9:27979708-27979730 AATTTGGAAGAGCATTCCACTGG + Intronic
1052963727 9:34322310-34322332 AAATTGGGAGTGACTACCACTGG - Intronic
1053170548 9:35877691-35877713 CAATTTGTGGAGCCTAACACTGG - Intergenic
1057742578 9:97724909-97724931 CAACTTGAAGAGGCTTCCACTGG - Intergenic
1194741150 X:97575793-97575815 CAATTGGATGAGCATACCCCTGG + Intronic
1195467774 X:105199241-105199263 CAACTGAAAGAGCTTCCCACGGG - Intronic
1198370795 X:135986473-135986495 GAATTGGAAGGGTCAACCACAGG - Intronic
1199839927 X:151635107-151635129 CAGCTGGAAGAGGCTCCCACTGG - Intronic
1200168958 X:154058157-154058179 CAACTGGCAGTGCCTGCCACAGG - Intronic
1201480998 Y:14439496-14439518 CAATTTGGAGAAGCTACCACTGG - Intergenic
1201747976 Y:17401444-17401466 CAATTTGAAGATCCCACAACAGG - Intergenic