ID: 1017806026

View in Genome Browser
Species Human (GRCh38)
Location 6:157946238-157946260
Sequence AGCTTGCTACAGATGCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017806026_1017806029 -8 Left 1017806026 6:157946238-157946260 CCACACTGCATCTGTAGCAAGCT No data
Right 1017806029 6:157946253-157946275 AGCAAGCTACTTGAGGGACAAGG No data
1017806026_1017806033 15 Left 1017806026 6:157946238-157946260 CCACACTGCATCTGTAGCAAGCT No data
Right 1017806033 6:157946276-157946298 TCATGTTTTGGAAGGAGTATGGG No data
1017806026_1017806031 7 Left 1017806026 6:157946238-157946260 CCACACTGCATCTGTAGCAAGCT No data
Right 1017806031 6:157946268-157946290 GGACAAGGTCATGTTTTGGAAGG No data
1017806026_1017806032 14 Left 1017806026 6:157946238-157946260 CCACACTGCATCTGTAGCAAGCT No data
Right 1017806032 6:157946275-157946297 GTCATGTTTTGGAAGGAGTATGG No data
1017806026_1017806030 3 Left 1017806026 6:157946238-157946260 CCACACTGCATCTGTAGCAAGCT No data
Right 1017806030 6:157946264-157946286 TGAGGGACAAGGTCATGTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017806026 Original CRISPR AGCTTGCTACAGATGCAGTG TGG (reversed) Intergenic
No off target data available for this crispr