ID: 1017807051

View in Genome Browser
Species Human (GRCh38)
Location 6:157955013-157955035
Sequence CTCCCACGTGTCCCCCTAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017807051_1017807061 29 Left 1017807051 6:157955013-157955035 CCACCTAGGGGGACACGTGGGAG No data
Right 1017807061 6:157955065-157955087 TGCTGCCCCCAACAGAAGCCGGG No data
1017807051_1017807056 -8 Left 1017807051 6:157955013-157955035 CCACCTAGGGGGACACGTGGGAG No data
Right 1017807056 6:157955028-157955050 CGTGGGAGGCAGTCCCAGGGAGG No data
1017807051_1017807059 6 Left 1017807051 6:157955013-157955035 CCACCTAGGGGGACACGTGGGAG No data
Right 1017807059 6:157955042-157955064 CCAGGGAGGCTGTACTAGAGAGG No data
1017807051_1017807060 28 Left 1017807051 6:157955013-157955035 CCACCTAGGGGGACACGTGGGAG No data
Right 1017807060 6:157955064-157955086 GTGCTGCCCCCAACAGAAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017807051 Original CRISPR CTCCCACGTGTCCCCCTAGG TGG (reversed) Intergenic
No off target data available for this crispr