ID: 1017807644

View in Genome Browser
Species Human (GRCh38)
Location 6:157959938-157959960
Sequence CTGCATCCTCACATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017807644_1017807647 -1 Left 1017807644 6:157959938-157959960 CCTTCCTCCATGTGAGGATGCAG No data
Right 1017807647 6:157959960-157959982 GCACACAGTTGCCATCTATAAGG No data
1017807644_1017807648 4 Left 1017807644 6:157959938-157959960 CCTTCCTCCATGTGAGGATGCAG No data
Right 1017807648 6:157959965-157959987 CAGTTGCCATCTATAAGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017807644 Original CRISPR CTGCATCCTCACATGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr