ID: 1017810625

View in Genome Browser
Species Human (GRCh38)
Location 6:157981486-157981508
Sequence GGGAGGCGCAGCGCCCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017810618_1017810625 3 Left 1017810618 6:157981460-157981482 CCAGGGTCGCAGGAGCCGACCAC No data
Right 1017810625 6:157981486-157981508 GGGAGGCGCAGCGCCCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017810625 Original CRISPR GGGAGGCGCAGCGCCCCCGG CGG Intergenic
No off target data available for this crispr