ID: 1017810676

View in Genome Browser
Species Human (GRCh38)
Location 6:157981660-157981682
Sequence CCCCGCAGGCGGGCGTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017810676_1017810685 -2 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810685 6:157981681-157981703 GGAGCCTCAGCCCCGGGGCGCGG 0: 1
1: 0
2: 2
3: 33
4: 345
1017810676_1017810682 -9 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810682 6:157981674-157981696 CCTGCGGGGAGCCTCAGCCCCGG 0: 1
1: 0
2: 2
3: 35
4: 326
1017810676_1017810696 27 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810696 6:157981710-157981732 GCAGCTGCCTGGCCGCTGGGGGG 0: 1
1: 0
2: 4
3: 33
4: 371
1017810676_1017810690 16 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810690 6:157981699-157981721 CGCGGCCTCGCGCAGCTGCCTGG 0: 1
1: 0
2: 1
3: 11
4: 170
1017810676_1017810694 25 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810694 6:157981708-157981730 GCGCAGCTGCCTGGCCGCTGGGG 0: 1
1: 0
2: 3
3: 22
4: 248
1017810676_1017810693 24 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810693 6:157981707-157981729 CGCGCAGCTGCCTGGCCGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 138
1017810676_1017810692 23 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810692 6:157981706-157981728 TCGCGCAGCTGCCTGGCCGCTGG 0: 1
1: 0
2: 0
3: 9
4: 115
1017810676_1017810683 -8 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810683 6:157981675-157981697 CTGCGGGGAGCCTCAGCCCCGGG 0: 1
1: 1
2: 4
3: 31
4: 335
1017810676_1017810684 -7 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810684 6:157981676-157981698 TGCGGGGAGCCTCAGCCCCGGGG 0: 1
1: 0
2: 1
3: 30
4: 215
1017810676_1017810695 26 Left 1017810676 6:157981660-157981682 CCGCTCCACGCCCGCCTGCGGGG No data
Right 1017810695 6:157981709-157981731 CGCAGCTGCCTGGCCGCTGGGGG 0: 1
1: 0
2: 1
3: 19
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017810676 Original CRISPR CCCCGCAGGCGGGCGTGGAG CGG (reversed) Intergenic
No off target data available for this crispr