ID: 1017812000

View in Genome Browser
Species Human (GRCh38)
Location 6:157990211-157990233
Sequence GTTCCACGGCTCCAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 56}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017811998_1017812000 -4 Left 1017811998 6:157990192-157990214 CCGCAGGAGGTGGGATCAAGTTC 0: 1
1: 0
2: 1
3: 9
4: 113
Right 1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 56
1017811993_1017812000 7 Left 1017811993 6:157990181-157990203 CCAGGCCCAGGCCGCAGGAGGTG 0: 1
1: 0
2: 7
3: 44
4: 456
Right 1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 56
1017811997_1017812000 1 Left 1017811997 6:157990187-157990209 CCAGGCCGCAGGAGGTGGGATCA 0: 1
1: 0
2: 2
3: 14
4: 176
Right 1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 56
1017811992_1017812000 8 Left 1017811992 6:157990180-157990202 CCCAGGCCCAGGCCGCAGGAGGT 0: 1
1: 0
2: 3
3: 24
4: 321
Right 1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 56
1017811990_1017812000 9 Left 1017811990 6:157990179-157990201 CCCCAGGCCCAGGCCGCAGGAGG 0: 1
1: 0
2: 3
3: 63
4: 500
Right 1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 56
1017811996_1017812000 2 Left 1017811996 6:157990186-157990208 CCCAGGCCGCAGGAGGTGGGATC 0: 1
1: 0
2: 2
3: 21
4: 146
Right 1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG 0: 1
1: 0
2: 1
3: 2
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017812000 Original CRISPR GTTCCACGGCTCCAGTGTGA AGG Intronic
904949111 1:34221872-34221894 GTTTCATGGCTCCTGAGTGAAGG - Intergenic
905944595 1:41890974-41890996 GTTTCAGGGCTCCCGTGTGGTGG - Intronic
906447338 1:45913785-45913807 CTACCAAGACTCCAGTGTGAGGG + Intronic
914913068 1:151802132-151802154 GTTGCAGCGCTCCAGGGTGAGGG + Exonic
917704008 1:177613122-177613144 GTTCCCTGGCTGCAGTGAGAGGG - Intergenic
920348270 1:205320903-205320925 GTGCCAGAGCTCCAGTGTGCTGG + Intronic
920387841 1:205580783-205580805 GTTCCATGTCTCCAGGGTGCTGG + Exonic
921623342 1:217350826-217350848 TTTCCATTGCACCAGTGTGAAGG + Intergenic
1065898162 10:30182622-30182644 GTCCCAGGGCTCCAGTGTCCTGG + Intergenic
1083171539 11:60926301-60926323 GTTCCACAGCTGGAGAGTGAAGG - Intronic
1084464230 11:69313003-69313025 GCTCCCAGGCTCCAGTGTGGAGG + Intronic
1087360249 11:97149730-97149752 GTTCCACCGCTCAAGTGGAAGGG - Intergenic
1089617495 11:119703187-119703209 CTTCCCCAGCTCCAGTGGGAGGG + Intronic
1096225744 12:49865888-49865910 CCCCCATGGCTCCAGTGTGATGG + Intergenic
1097148031 12:56954979-56955001 GGTCAACGTCTCCAGTGTCATGG - Exonic
1098703433 12:73657606-73657628 GTTCCACTGCTACATTGTTAGGG - Intergenic
1104747724 12:131220484-131220506 GCGCCACGGCTCCACAGTGAGGG - Intergenic
1112740289 13:102465529-102465551 GATCCACGGCATCAGTGAGAGGG + Intergenic
1112807660 13:103180876-103180898 GTCCCAGGGCTCCACTTTGAAGG + Intergenic
1120245677 14:82003514-82003536 GTTCCATGGCCCTAGTGGGAAGG - Intergenic
1124159683 15:27256814-27256836 GTTCCACTGCTACACTTTGAAGG + Intronic
1131729078 15:95260124-95260146 GTCCCAGGGCTCTAGTCTGAGGG - Intergenic
1133849093 16:9485276-9485298 GTCCCCAGGCTCCAGTGAGATGG + Intergenic
1140672756 16:77294933-77294955 GGTCCAAGGCTCCATTGTGGAGG + Exonic
1149835843 17:59911582-59911604 GTTCCCAGGCTGGAGTGTGATGG + Intronic
1164070536 19:21764090-21764112 CTTCCATGGCTGCAGTGAGAAGG + Intronic
1164605651 19:29596089-29596111 GCTCCAGGTTTCCAGTGTGAAGG + Intergenic
932243544 2:70177230-70177252 TTTCCCAGGCTGCAGTGTGATGG - Intronic
948083957 2:235230632-235230654 GTTCCAGGGCTCCGGTGTTGTGG - Intergenic
948858312 2:240740865-240740887 GTTCCAGGGCCCCAGGGTGGAGG - Intronic
1171142750 20:22757282-22757304 GTTCCACGGCTGCACTCGGATGG + Intergenic
1171374942 20:24685982-24686004 GTTCCAAGGCTGCAGGCTGAGGG - Intergenic
1176048061 20:63102831-63102853 GTTCCCAGGCTGCAGCGTGAGGG - Intergenic
1184310353 22:43637245-43637267 CTTCTACAGCTCTAGTGTGAGGG - Intronic
954227423 3:49191251-49191273 GATCCACGTCTTCAGTGGGATGG - Intronic
955879910 3:63532237-63532259 GTTCCCTGGCTCCATAGTGAAGG + Intronic
957485406 3:80855333-80855355 TTTCCATGGCTTCAGAGTGAAGG - Intergenic
961546473 3:127637516-127637538 CTACCATGCCTCCAGTGTGAGGG - Intronic
961737121 3:129009460-129009482 GTTCCAGGACTTCAGTGGGATGG - Intronic
972860200 4:43159112-43159134 GTATCACAGCTGCAGTGTGATGG + Intergenic
985100144 4:186450756-186450778 GTACCACGGCTCCATGGTCACGG + Intronic
994314818 5:98320597-98320619 CTGCAACGGCTCCAGGGTGAGGG + Intergenic
1000347607 5:160327962-160327984 ATTCCATGGCCCCAGTGTCAGGG - Intronic
1016382631 6:143500365-143500387 CTTCCACGGCTCCAGTTTGAAGG - Intronic
1017049511 6:150377263-150377285 GCTCCACTGCTCTAGAGTGAAGG + Intronic
1017812000 6:157990211-157990233 GTTCCACGGCTCCAGTGTGAAGG + Intronic
1026070296 7:67112845-67112867 GTCACGTGGCTCCAGTGTGATGG - Intronic
1026501450 7:70946490-70946512 GTTCCAAGGCTCCTCTGGGAAGG - Intergenic
1026706614 7:72699424-72699446 GTCACGTGGCTCCAGTGTGATGG + Intronic
1049098321 8:140561832-140561854 GTTCCCGGGCACCAGTGTGAGGG + Intronic
1049936610 9:505556-505578 GTTCCACGGGACCCGGGTGAAGG - Intronic
1055711052 9:79062508-79062530 GTTCCAAGGAGCCAGTGTGAGGG + Intergenic
1061032167 9:128091921-128091943 GTGCCACGGCTCCAGAGAGGGGG + Intronic
1061152585 9:128837350-128837372 GTTGCAGGGATCCAATGTGATGG - Intronic
1062113165 9:134793399-134793421 GTTCCACAGCTCCAGTCACAGGG + Intronic
1191700201 X:64033791-64033813 GTACAACTGCTCCAGTGTGCTGG - Intergenic
1195164015 X:102199352-102199374 GTTCCTGGGCTCCACAGTGAAGG + Intergenic
1195194846 X:102487743-102487765 GTTCCTGGGCTCCACAGTGAAGG - Intergenic
1199902947 X:152195493-152195515 GTTTCACTGGTCCAGTGTCAAGG + Intronic
1201375923 Y:13318961-13318983 GTCCCCAGGCTGCAGTGTGATGG - Intronic