ID: 1017812605

View in Genome Browser
Species Human (GRCh38)
Location 6:157994873-157994895
Sequence GAACCCCCTGGGACTCCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 234}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017812605_1017812620 25 Left 1017812605 6:157994873-157994895 CCCCAGGGAGTCCCAGGGGGTTC 0: 1
1: 0
2: 1
3: 15
4: 234
Right 1017812620 6:157994921-157994943 CCTGCACCACCTTGCTTTCCAGG 0: 1
1: 0
2: 2
3: 17
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017812605 Original CRISPR GAACCCCCTGGGACTCCCTG GGG (reversed) Intronic
900094030 1:933103-933125 GAAGCCCCTGAGAGTCTCTGTGG - Intronic
900402631 1:2478822-2478844 GAGCTCCCTGGGACTCAGTGAGG + Intronic
900481445 1:2901412-2901434 GAAGCCGCTGAGACTCCTTGTGG + Intergenic
900536695 1:3182205-3182227 AAACCCCCTTGTACTCCCTCTGG + Intronic
901008378 1:6183043-6183065 GAACCCCCAAGGCCTGCCTGAGG + Intronic
902460760 1:16574747-16574769 AAACCAGCTAGGACTCCCTGGGG - Intronic
902461523 1:16581011-16581033 AAACCAGCTAGGACTCCCTGGGG - Intronic
902462307 1:16587316-16587338 AAACCAGCTAGGACTCCCTGGGG - Intronic
902622887 1:17660629-17660651 AAAGCCCCTGGGTCTCCCTCAGG - Intronic
902838879 1:19063079-19063101 GAAGCCCCTGGGAATGCCTGTGG - Intergenic
903735092 1:25524750-25524772 CAAGTCCCTGGGACTCTCTGGGG - Intergenic
903811719 1:26038415-26038437 GAATCCCCTGGGACACTCTCAGG + Exonic
906095551 1:43221593-43221615 GTATCCCCTGGAACTCACTGTGG + Intronic
906514252 1:46429543-46429565 GACCCTCCTGAGAGTCCCTGTGG + Intergenic
907333715 1:53687351-53687373 GAACTCCATGGGAATCCCTTAGG - Intronic
908402354 1:63783266-63783288 TAACTCCCTGGGACACCCTTTGG - Intronic
908656598 1:66395014-66395036 GAAGCCTCAGGAACTCCCTGTGG - Intergenic
910522157 1:88135173-88135195 GAACCCCCTGTGATTCCTTTGGG - Intergenic
911144780 1:94541720-94541742 GCACCCCCTCGCACTCCCTCTGG - Exonic
913603163 1:120441201-120441223 AAACCAGCTAGGACTCCCTGGGG + Intergenic
913603911 1:120447553-120447575 AAACCAGCTAGGACTCCCTGGGG + Intergenic
913604660 1:120453832-120453854 AAACCAGCTAGGACTCCCTGGGG + Intergenic
913641532 1:120816545-120816567 AAACCAGCTAGGACTCCCTGGGG + Intronic
913990413 1:143606771-143606793 AAACCAGCTAGGACTCCCTGGGG - Intergenic
914083881 1:144435371-144435393 AAACCAGCTAGGACTCCCTGGGG - Intronic
914189901 1:145400649-145400671 AAACCAGCTAGGACTCCCTGGGG - Intronic
914276950 1:146133783-146133805 AAACCAGCTAGGACTCCCTGGGG - Intronic
914277701 1:146140075-146140097 AAACCAGCTAGGACTCCCTGGGG - Intronic
914364340 1:146964816-146964838 AAACCAGCTAGGACTCCCTGGGG + Intronic
914365859 1:146977389-146977411 AAACCAGCTAGGACTCCCTGGGG + Intronic
914486584 1:148116053-148116075 AAACCAGCTAGGACTCCCTGGGG - Intronic
914537994 1:148584731-148584753 AAACCAGCTAGGACTCCCTGGGG - Intronic
914538747 1:148591023-148591045 AAACCAGCTAGGACTCCCTGGGG - Intronic
914586913 1:149071194-149071216 AAACCAGCTAGGACTCCCTGGGG - Intronic
914627927 1:149480602-149480624 AAACCAGCTAGGACTCCCTGGGG + Intergenic
915635263 1:157181884-157181906 GAAGGCCCTGGGTGTCCCTGTGG + Intergenic
917115508 1:171599360-171599382 GAATCCCCTAGGGCTCCATGAGG - Intergenic
919861654 1:201742691-201742713 CAACCCACAGAGACTCCCTGGGG + Intronic
920500342 1:206481344-206481366 AAACTCCCTGGAGCTCCCTGAGG - Intronic
921185316 1:212665301-212665323 AAGCCCCCTGGGACTCACTGCGG + Intergenic
923540768 1:234886424-234886446 AAAACCCCTGCGGCTCCCTGGGG - Intergenic
923595831 1:235360459-235360481 TAACCCCTTGGGACCCACTGGGG - Intergenic
1062802218 10:389006-389028 GAACCCCCAGAGAATCCCCGTGG - Intronic
1063618391 10:7622186-7622208 GAGCCCCCTGGGAGTCCTGGTGG - Intronic
1064380696 10:14838784-14838806 GGACCCCCCGGGACACCCAGCGG - Intronic
1067217590 10:44315964-44315986 GAGACCCCTGGGGCTCCCTCAGG + Intergenic
1069748190 10:70729308-70729330 GAACCCCCAGGGACTCATCGTGG - Exonic
1069783078 10:70969152-70969174 TAGGACCCTGGGACTCCCTGGGG - Intergenic
1070326471 10:75392727-75392749 GAACTTCCTGTGGCTCCCTGTGG - Intergenic
1070671077 10:78377595-78377617 TAGGCCCCTGGGGCTCCCTGTGG + Intergenic
1071293917 10:84205767-84205789 GACTCCCCTGCGCCTCCCTGTGG + Intronic
1072057677 10:91776476-91776498 GAACCCTCTGGGATATCCTGTGG - Intergenic
1073116255 10:101093534-101093556 GAAGCCCCAGGGGCTCCATGGGG - Intronic
1073133427 10:101205550-101205572 TCGCCACCTGGGACTCCCTGAGG + Intergenic
1075698115 10:124450266-124450288 CAACCCTCTGGGACTCTCCGAGG + Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076245721 10:128945884-128945906 GAGCCCCCTGGAGCCCCCTGGGG - Intergenic
1076268469 10:129129826-129129848 GACCCCCCTGTGACTCCATCTGG + Intergenic
1077210528 11:1369167-1369189 GAAGCCCCTGGGACTCCTGCAGG - Intergenic
1077298176 11:1835655-1835677 GAACCCGCTGTGGCTCCCTCGGG - Intronic
1078090100 11:8259694-8259716 GAGGCCCCTGGGATTCTCTGTGG + Intronic
1079130324 11:17743557-17743579 GCAGCCCCTGGGACTCCATATGG + Intronic
1081701019 11:45152902-45152924 AAACCCTCTGAGGCTCCCTGTGG - Intronic
1083103816 11:60337619-60337641 GATCCCTCCGGGACTTCCTGAGG + Intronic
1083466826 11:62852952-62852974 GAACCCACTGGGACTGGCTGGGG - Intergenic
1083768017 11:64851421-64851443 GAACCCCCTGGGGCTGCCCCAGG - Intergenic
1084331104 11:68431167-68431189 GAACCCCCAGGAACTCCCACGGG - Intronic
1084390999 11:68876849-68876871 GAATCCCCTGGGACTGACTCTGG - Intergenic
1084878122 11:72149114-72149136 TAACAGCCTGGGACTCCTTGGGG + Intergenic
1085391935 11:76186666-76186688 GGACCCCCTGGCCCACCCTGGGG - Exonic
1087094460 11:94306188-94306210 GATTCCCCTGGGTCTCTCTGGGG + Intronic
1087292965 11:96340091-96340113 GAAGACCCTGGGAATCTCTGGGG - Intronic
1090333818 11:125950042-125950064 GGAGCCGCTGGGACTCACTGAGG + Intergenic
1090858715 11:130634236-130634258 GAATCCTCTGGGCATCCCTGTGG + Intergenic
1100042942 12:90342611-90342633 GCTACCCTTGGGACTCCCTGAGG + Intergenic
1102624417 12:114223327-114223349 CTCCCACCTGGGACTCCCTGGGG - Intergenic
1104017712 12:124971678-124971700 GAAGCCACTGGGACTCCTGGGGG - Intronic
1110409180 13:75185143-75185165 GAAGCCCCTGGGACCCCCACAGG + Intergenic
1113334703 13:109366736-109366758 GGAATCCCTGGGACTCACTGTGG + Intergenic
1113569866 13:111346145-111346167 GAAGCCCCTGTGACTCACTAGGG + Intergenic
1113702186 13:112396101-112396123 AGACACCCTGGGATTCCCTGAGG - Intronic
1119860721 14:77934066-77934088 GATCTCCCTGGGAAACCCTGAGG - Intronic
1121829282 14:97035590-97035612 GATCTGCCAGGGACTCCCTGGGG + Intergenic
1122348318 14:101073775-101073797 GAACCCCCAGGGAGACCCTTCGG + Intergenic
1122352212 14:101102862-101102884 GATCCCCCCAGGGCTCCCTGGGG - Intergenic
1122904902 14:104797136-104797158 GAGCCACCTGGGGCTCCCTCTGG + Intergenic
1124537841 15:30560586-30560608 GAACCTCATGGCTCTCCCTGGGG + Exonic
1124636309 15:31367061-31367083 AAAGCTCCTGGGGCTCCCTGCGG + Intronic
1124785040 15:32671812-32671834 GAACAGCCTGGGACTCCCTGAGG - Intronic
1127716184 15:61651418-61651440 GCACTCCCTTGGACCCCCTGGGG - Intergenic
1128123522 15:65172755-65172777 CTACCTCCTGGGACTCACTGTGG - Intronic
1129377768 15:75145052-75145074 GCACCCCCTTGGCCTCCCTCTGG + Intergenic
1132233977 15:100205577-100205599 GAAGCCCCTGAGCCTCTCTGGGG - Intronic
1132839864 16:1973746-1973768 GAGCCCCCTGGCTCTCACTGGGG + Intronic
1132877047 16:2144593-2144615 GAGCGCCCTGGGTCTCCTTGGGG - Intronic
1133416220 16:5609173-5609195 GAACCACCTGAAACTACCTGGGG + Intergenic
1133423333 16:5665759-5665781 GAACCCCCTGTGAGGGCCTGAGG - Intergenic
1133660754 16:7915073-7915095 CAACCACCTGGGACACCCAGAGG + Intergenic
1134056017 16:11170349-11170371 GAACCCACGTGGGCTCCCTGGGG - Intronic
1134121182 16:11586301-11586323 GAGGCCCCTGGGAGACCCTGGGG - Intronic
1138393808 16:56689436-56689458 GCACACCCTGAGACTCACTGTGG + Intronic
1139650928 16:68361716-68361738 GAAACGCCAGGTACTCCCTGCGG + Exonic
1140017397 16:71200826-71200848 GAACACCCTCAGACACCCTGGGG + Intronic
1142075458 16:88115064-88115086 GAACCACCTGCGTTTCCCTGCGG - Intronic
1142294486 16:89211473-89211495 GCACCCCCTGGCCCTTCCTGTGG + Intergenic
1143882410 17:10039833-10039855 GCACCCTCTGGGGCTCCCAGAGG + Intronic
1143934476 17:10468358-10468380 GAACCCCCTGCAACAACCTGAGG - Intronic
1145036095 17:19541615-19541637 GATCCCGCTGGGACTCCAAGTGG + Intronic
1145274978 17:21423760-21423782 GGAGCCCCTGGGACCCCTTGTGG - Intergenic
1145312832 17:21709660-21709682 GGAGCCCCTGGGACCCCTTGTGG - Intergenic
1145784730 17:27586497-27586519 GCTCCCCCTGTGCCTCCCTGGGG - Intronic
1147332704 17:39708256-39708278 CACCCCCCAGGGCCTCCCTGGGG - Intronic
1147977261 17:44255051-44255073 GAAGCACATGGGACTCCCAGAGG + Intronic
1148080537 17:44965713-44965735 GGACCTGCTGGGACTTCCTGAGG + Intronic
1148695162 17:49554449-49554471 GAGCTCCCTGGCACTCCCTCAGG + Intergenic
1149334013 17:55616870-55616892 GAATCCCCTGGTCTTCCCTGAGG - Intergenic
1152586415 17:81191398-81191420 GAGCCCCCCAGGACCCCCTGAGG - Intronic
1153685282 18:7538845-7538867 CTATGCCCTGGGACTCCCTGGGG - Intergenic
1157331605 18:46708181-46708203 TGACTCCCTGGGACTTCCTGGGG - Intronic
1157600863 18:48892431-48892453 GAGCTCCCTGGGGCTCTCTGAGG + Intergenic
1157618505 18:49001945-49001967 GGCCCCTCTAGGACTCCCTGTGG - Intergenic
1160732627 19:648202-648224 GAACCCCCCTGGCCTCACTGGGG - Exonic
1161010347 19:1956828-1956850 GAGCCTCCTGGGGCTCTCTGGGG - Intronic
1161046626 19:2138373-2138395 GGACCCCATGGGGCTCCCTCAGG + Intronic
1161597444 19:5157845-5157867 GAACCCCCTGCCACTTCCTGGGG - Intergenic
1161808658 19:6459371-6459393 GAGCCACCAGGGACTACCTGTGG - Intronic
1162034910 19:7933554-7933576 CGACCCCCAGGGCCTCCCTGGGG + Exonic
1162739104 19:12763820-12763842 AAACCCCCTGGGACATACTGGGG + Intronic
1163371442 19:16903463-16903485 GAACCCTCTGGGGGTCCCTGGGG + Intronic
1166326891 19:42056550-42056572 GAACCCTCTCGCCCTCCCTGAGG - Intronic
1167606281 19:50482491-50482513 GAAGCCCCTGGGGCTGCATGGGG - Exonic
1202677960 1_KI270711v1_random:24758-24780 AAACCAGCTAGGACTCCCTGGGG - Intergenic
925358040 2:3256387-3256409 GTACACCCTGGGTCTCCCCGTGG + Intronic
925404096 2:3594917-3594939 GGAACGCCTGGAACTCCCTGAGG - Intronic
927192189 2:20524420-20524442 TAACCCCCTGAGACTCCTCGCGG - Intergenic
927911580 2:26903643-26903665 GAATCCCCTGGGTCTGCCTTGGG + Intronic
928366113 2:30704786-30704808 AAACCCCATGGGAATCTCTGAGG - Intergenic
930781181 2:55225703-55225725 GAACCCCCTGGCACGCAGTGGGG - Intronic
934240933 2:90270222-90270244 GCAACCCCTGGGCCTCCCCGTGG + Intergenic
935328853 2:101961885-101961907 CTACCCCATGGGACCCCCTGTGG + Intergenic
935359862 2:102238121-102238143 GACCCCCCTGGGAATCCCCAGGG + Intronic
936556850 2:113503719-113503741 CGACTCCCCGGGACTCCCTGCGG + Intergenic
937289986 2:120776344-120776366 GAGCCCACTGGGCCTCCCTTTGG - Intronic
937340720 2:121088856-121088878 GAGCCCCTTGGGAGTTCCTGGGG - Intergenic
939278784 2:140036482-140036504 GAACCTCATGGGACTCCTTGAGG - Intergenic
939542616 2:143512432-143512454 GAACACCCTGAGATTCCCTTGGG - Intronic
942648136 2:178136761-178136783 GGACCTCCTGGGATTTCCTGGGG + Intronic
945310741 2:208309432-208309454 GCACTCCCTGGCACTCCCTAGGG + Intronic
947614179 2:231544520-231544542 GGACCCCCTGAGATACCCTGTGG - Intergenic
947710740 2:232314109-232314131 GAGCCCTCTGGGCCTGCCTGTGG + Intronic
948676900 2:239602083-239602105 GGGCCCCCTGGCTCTCCCTGGGG + Intergenic
948899551 2:240949462-240949484 GAACCCTTTGGGACTTCCTAGGG - Intronic
948950749 2:241249693-241249715 GAACCGGATTGGACTCCCTGGGG - Intronic
1170334117 20:15249202-15249224 TAACCTCCTGAGACTGCCTGAGG - Intronic
1171136172 20:22696498-22696520 TAACCCTCTGTGACTCTCTGTGG + Intergenic
1175132003 20:56796365-56796387 GGACCCCCTCTGACTCCCAGGGG + Intergenic
1175275795 20:57769920-57769942 GAATCCCCCTGGAGTCCCTGTGG + Intergenic
1175718118 20:61269031-61269053 GAACCCCATGGAAAGCCCTGTGG + Intronic
1176236954 20:64057869-64057891 GAACCACCTGGACCTCCCTGGGG + Intronic
1176365277 21:6029074-6029096 GACCTCCTTGGGACACCCTGTGG - Intergenic
1176597326 21:8759170-8759192 CGGCCCCCTGGGATTCCCTGAGG - Intergenic
1176683250 21:9830602-9830624 CAACCCCCAGGCACCCCCTGAGG + Intergenic
1177281579 21:18988270-18988292 GAACCAGCAGGGACTCCCTTTGG + Intergenic
1179758241 21:43509471-43509493 GACCTCCTTGGGACACCCTGTGG + Intergenic
1179805693 21:43835662-43835684 GATCCTCCAGGGGCTCCCTGTGG - Intergenic
1181577243 22:23802757-23802779 AATCCTCCTGGGACTCCCTCAGG + Intronic
1184112963 22:42405923-42405945 GCAGCCCCTGGGGCTCCCGGGGG + Intronic
1184767992 22:46581978-46582000 CACCCACCTGGGCCTCCCTGTGG - Intronic
1185045590 22:48527206-48527228 CGACCCCGTGGCACTCCCTGTGG + Intronic
949616114 3:5755642-5755664 AAACCCTCTGGGACTCCCTTTGG + Intergenic
949829433 3:8198107-8198129 TAATCCCCTGGGGGTCCCTGAGG - Intergenic
950533377 3:13566080-13566102 AAAGCCCCTGGGACTGGCTGCGG - Intronic
950640634 3:14346064-14346086 TAAGCCCCTGGGACTGGCTGTGG - Intergenic
953180038 3:40586297-40586319 GAACTCCCTGGGAGACCCTGGGG + Intergenic
953907524 3:46875803-46875825 AAACCCTTTGGGGCTCCCTGAGG - Intronic
956738111 3:72254432-72254454 GAACTCCTGGGGAGTCCCTGAGG + Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968910077 4:3473077-3473099 GAGCCCCCTGGGCCACACTGAGG - Intronic
970850034 4:20590499-20590521 GCATAGCCTGGGACTCCCTGGGG - Intronic
976617113 4:87089091-87089113 GAACCACCTTTGACTTCCTGGGG + Intronic
981600718 4:146485488-146485510 GGGCCTACTGGGACTCCCTGAGG - Intronic
986316482 5:6592080-6592102 GCACCCCGTGGGACCCGCTGGGG + Intergenic
986725654 5:10594602-10594624 GAACCCCATGTGGCTCCCAGGGG - Intronic
987760488 5:22156004-22156026 GTACCCCTTGGGGTTCCCTGAGG + Intronic
989185101 5:38616090-38616112 GAGCTCCTTGGGTCTCCCTGAGG - Intergenic
990994351 5:61716410-61716432 ACACCCTCTGGGACTTCCTGGGG + Intronic
991895264 5:71389447-71389469 GTACCCCTTGGGGTTCCCTGAGG + Intergenic
992215280 5:74519282-74519304 GAAGCCCTTGGGACTCCAGGAGG + Intergenic
992392019 5:76338178-76338200 GCAGCCACTGGAACTCCCTGGGG + Intronic
995047708 5:107670262-107670284 GCAGCCCCGGGGACTCCCAGGGG + Intronic
1001826997 5:174753047-174753069 GAACCCAGCGGGACTCACTGGGG - Intergenic
1002415268 5:179117195-179117217 GAACCCCCTGTGTTTCCCTGAGG - Intronic
1003161935 6:3643612-3643634 CAACCCCATGGAACACCCTGGGG - Intergenic
1006899822 6:37492847-37492869 GAACCCCGTGTGACTTGCTGTGG - Intronic
1007360586 6:41352596-41352618 AAACACCCAGGGACTTCCTGTGG + Intergenic
1013119128 6:107125907-107125929 GAGGCCCCTGGAAGTCCCTGGGG - Intergenic
1014477555 6:121892166-121892188 GAACTCACTGTGACTTCCTGAGG + Intergenic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1015970056 6:138734691-138734713 GAGCCCACTGGGACTGACTGAGG + Intergenic
1016296206 6:142575802-142575824 TAACAGCCTGGGACTCCTTGGGG + Intergenic
1017812605 6:157994873-157994895 GAACCCCCTGGGACTCCCTGGGG - Intronic
1018067904 6:160136475-160136497 GAGCCACCTGGGAGCCCCTGGGG - Intronic
1018421470 6:163644027-163644049 CAACCCATTGAGACTCCCTGTGG + Intergenic
1018494667 6:164337393-164337415 GAAACCCCGTGGGCTCCCTGGGG - Intergenic
1019328875 7:452986-453008 GAAGCCCCGGTGCCTCCCTGCGG - Intergenic
1022827226 7:34027196-34027218 GAACCCCCTGGAACTGTCTTGGG - Intronic
1023791926 7:43759152-43759174 GACCCGCCTGGGATGCCCTGGGG + Intronic
1026772758 7:73212645-73212667 GGTCCCTCTGGGACTCACTGAGG - Intergenic
1027013622 7:74766045-74766067 GGTCCCTCTGGGACTCACTGAGG - Intergenic
1027074416 7:75179988-75180010 GGTCCCTCTGGGACTCACTGAGG + Intergenic
1027165307 7:75829974-75829996 CCTCCCCCTGGGGCTCCCTGGGG - Intergenic
1027165836 7:75833770-75833792 CCTCCCCCTGGGGCTCCCTGGGG + Intergenic
1028621855 7:92835175-92835197 GAGCCCCCAGGGACTGCCCGGGG + Intronic
1028639729 7:93029083-93029105 GAGCCCCCAGGCACCCCCTGGGG + Intergenic
1030008865 7:105145869-105145891 GAGGCTCCTGGGACTGCCTGGGG - Intronic
1031913782 7:127543851-127543873 AAACCCCAGGGGACTCACTGGGG + Intergenic
1031972999 7:128077283-128077305 GAAGGACCTGGGACTCCCTGAGG + Intronic
1032265254 7:130366012-130366034 GCGCTCCCTGGGCCTCCCTGGGG + Intronic
1033030509 7:137821315-137821337 GCACCCCCTGTGACTTCCAGTGG - Intronic
1034902399 7:154915599-154915621 GAACCCCCTTGGGTTCTCTGGGG - Intergenic
1034969489 7:155410249-155410271 GCACCCTTTGGGACTCCCTGAGG + Intergenic
1034978506 7:155461320-155461342 CAACCCCCTGGCGTTCCCTGTGG - Intronic
1035167852 7:157002414-157002436 GAGCCCCCTGGGCCTCCGTCTGG + Intronic
1035295652 7:157865603-157865625 GATCCTCCTGGCACTCGCTGAGG - Intronic
1036286485 8:7447944-7447966 GATCCACCTGGGCCACCCTGAGG + Intronic
1036334992 8:7863584-7863606 GATCCACCTGGGCCACCCTGCGG - Exonic
1038450938 8:27638408-27638430 GAAGTCCCTGGTACTCCCTGGGG + Intronic
1039824368 8:41160616-41160638 AAGTCTCCTGGGACTCCCTGAGG - Intergenic
1040301448 8:46190055-46190077 GAAGCCCCTAGGACTGCCTCGGG + Intergenic
1042106193 8:65328887-65328909 GAACCCACTGAGACACTCTGTGG + Intergenic
1048011062 8:130456671-130456693 GAGTCCCCTGGGTCTGCCTGGGG - Intergenic
1048460905 8:134620868-134620890 GAAACCCCTGGGGCTCCCTTCGG - Intronic
1049343208 8:142124812-142124834 GAAACCCCTGGGGTCCCCTGAGG + Intergenic
1049665358 8:143840518-143840540 GCTCGCCCTGGGACTCCCTGAGG - Intronic
1051151245 9:14081411-14081433 TAAGCCCCGGGGACACCCTGTGG - Intergenic
1052999631 9:34570855-34570877 GAACTTCCTGGGGCTTCCTGTGG + Intronic
1056754367 9:89372830-89372852 GAAGGCCCTGGGACACCCTAGGG - Intronic
1057282903 9:93725778-93725800 GACTCCCTGGGGACTCCCTGTGG - Intergenic
1058142923 9:101377224-101377246 GAACCAGCAGGGACTCCCTTTGG - Intronic
1059004194 9:110383737-110383759 GGAGCCCCTGGGGCTCCATGTGG - Intronic
1059280082 9:113125392-113125414 TAACCTCTTGGGATTCCCTGAGG + Intergenic
1060216216 9:121740021-121740043 GACCCCACTGGGTCTCCTTGAGG - Intronic
1061281840 9:129602041-129602063 GACACCCCTGGGTCTACCTGGGG - Intergenic
1061371590 9:130200670-130200692 GAGCCCCCAGGAACGCCCTGTGG - Intronic
1062076851 9:134594367-134594389 GTGCTCCTTGGGACTCCCTGGGG - Intergenic
1062315651 9:135965776-135965798 CCACTCTCTGGGACTCCCTGGGG + Intergenic
1062592032 9:137278542-137278564 GCACCCCACGGGACTCCCAGGGG + Intronic
1187805819 X:23119268-23119290 GAACTCCCGGGGAAGCCCTGGGG - Intergenic
1196781775 X:119390010-119390032 CCACCTCCTGGCACTCCCTGAGG - Intergenic
1197770657 X:130087113-130087135 GCACCCCCTGGAAGTGCCTGCGG + Intronic
1199856986 X:151767407-151767429 AGAACCACTGGGACTCCCTGGGG - Intergenic