ID: 1017815673

View in Genome Browser
Species Human (GRCh38)
Location 6:158014850-158014872
Sequence TACCCTCAGCCCCCCAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 201}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017815673_1017815676 -7 Left 1017815673 6:158014850-158014872 CCACTCCTGGGGGGCTGAGGGTA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1017815676 6:158014866-158014888 GAGGGTAGGAAGAGCTTCAGAGG No data
1017815673_1017815679 -2 Left 1017815673 6:158014850-158014872 CCACTCCTGGGGGGCTGAGGGTA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1017815679 6:158014871-158014893 TAGGAAGAGCTTCAGAGGGGAGG 0: 1
1: 0
2: 2
3: 17
4: 325
1017815673_1017815678 -5 Left 1017815673 6:158014850-158014872 CCACTCCTGGGGGGCTGAGGGTA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1017815678 6:158014868-158014890 GGGTAGGAAGAGCTTCAGAGGGG 0: 1
1: 0
2: 2
3: 58
4: 342
1017815673_1017815677 -6 Left 1017815673 6:158014850-158014872 CCACTCCTGGGGGGCTGAGGGTA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1017815677 6:158014867-158014889 AGGGTAGGAAGAGCTTCAGAGGG 0: 1
1: 0
2: 3
3: 33
4: 301
1017815673_1017815681 3 Left 1017815673 6:158014850-158014872 CCACTCCTGGGGGGCTGAGGGTA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1017815681 6:158014876-158014898 AGAGCTTCAGAGGGGAGGATGGG 0: 1
1: 0
2: 3
3: 33
4: 294
1017815673_1017815680 2 Left 1017815673 6:158014850-158014872 CCACTCCTGGGGGGCTGAGGGTA 0: 1
1: 0
2: 2
3: 10
4: 201
Right 1017815680 6:158014875-158014897 AAGAGCTTCAGAGGGGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017815673 Original CRISPR TACCCTCAGCCCCCCAGGAG TGG (reversed) Intronic
902606766 1:17573420-17573442 GACCCTCAGCCCCACATCAGGGG - Intronic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
905926348 1:41752504-41752526 TTCCCTCAGCCCCCTAGGCTGGG - Intronic
907407924 1:54265152-54265174 CACCCACAGCCCCCAAGGAAAGG + Intronic
908511621 1:64854233-64854255 AACCCTCACACCACCAGGAGTGG - Intronic
912776243 1:112508180-112508202 TACTCTCAGCCCCGCCCGAGAGG + Intronic
912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG + Intronic
915339173 1:155166998-155167020 TTCCCTCTGTCCCCCAGGGGCGG + Intergenic
915554944 1:156656209-156656231 CAGCCTGAGCCCTCCAGGAGAGG - Intronic
916024804 1:160824102-160824124 TACCCTCAACCCTTGAGGAGAGG - Intronic
919608429 1:199715285-199715307 CACCCTCCACCCCCCAGTAGTGG - Intergenic
919897416 1:202017993-202018015 TGCCCCCAGCCCTCCAGAAGAGG - Intergenic
922277030 1:224088675-224088697 TACACTCAGCACCTCAGGACAGG + Intergenic
922842338 1:228653227-228653249 TAACCTCTGCCCCCTGGGAGGGG + Intergenic
923087393 1:230711965-230711987 TACCCTGAGACCCCCAGAAGAGG + Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1064400275 10:15015208-15015230 TACCCACAGTCCTCCAGGTGTGG + Intergenic
1065956144 10:30695308-30695330 ACCCCTGAGCCCCCCAAGAGTGG - Intergenic
1067693669 10:48520373-48520395 AGCCCTCAGCAGCCCAGGAGGGG + Intronic
1069867318 10:71511843-71511865 TGCCATCAGCCACCCAGGAGAGG - Intronic
1069942537 10:71965081-71965103 CCCCCGCAGCCCCCAAGGAGAGG + Intronic
1074543612 10:114385866-114385888 TACCTGCAGCCTCCCTGGAGTGG - Intronic
1075008841 10:118851199-118851221 AACCCTCAGCACTCCAGGATAGG + Intergenic
1075781167 10:125018125-125018147 TACCCTGAGTCCCACAGCAGGGG - Intronic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076837939 10:133030444-133030466 CACCCTCAACCCACCAGGCGCGG + Intergenic
1077043324 11:534046-534068 TCGTCTCAGCACCCCAGGAGAGG - Intronic
1077058008 11:605339-605361 TGCCCACAGCCCCCAGGGAGAGG - Intronic
1077365821 11:2161194-2161216 AGCCCTCAGCCCTCCAGGACAGG - Exonic
1077386587 11:2272100-2272122 TGCCCCCAGGCTCCCAGGAGGGG - Intergenic
1077519001 11:3020142-3020164 CACTCTCAGGCCCCCAGCAGAGG - Intronic
1078916510 11:15783678-15783700 TTCCCTCAGGCCCTCAGGTGCGG - Intergenic
1079732857 11:23957561-23957583 TACCCCCAGCCACATAGGAGTGG + Intergenic
1083386095 11:62311403-62311425 CACGCCCAGCCCCGCAGGAGAGG - Intergenic
1084277188 11:68059183-68059205 AACCCTCAGCCAGCCAGGCGCGG - Intronic
1084505138 11:69561779-69561801 CCACCTCAGCCTCCCAGGAGTGG - Intergenic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1085249776 11:75135342-75135364 GACCCTCATCCCGCTAGGAGAGG - Intronic
1085349623 11:75790171-75790193 GGCCATCTGCCCCCCAGGAGTGG + Exonic
1088903468 11:114136285-114136307 CACCCTCAGCCCCCAAACAGTGG - Intronic
1089381774 11:118037997-118038019 CACCCTCAGCCCCACAGCAAGGG - Intergenic
1089762744 11:120740373-120740395 TTCCCTCACCCCCGCATGAGTGG + Intronic
1092230433 12:6772936-6772958 GACCTCCAGCCCCACAGGAGGGG + Intronic
1092242451 12:6843547-6843569 TTCCCTGAACCCCTCAGGAGGGG - Intronic
1096104043 12:48986451-48986473 TACCCTCAGCATCCCAAGAATGG - Intergenic
1096585182 12:52615237-52615259 TCCCTTCAGTCCCCCAGCAGTGG - Intronic
1096807789 12:54150947-54150969 TTCCCTCAGCACCTCAGGTGAGG + Intergenic
1099817576 12:87668732-87668754 TAGCCTCATGCCCTCAGGAGAGG + Intergenic
1101968538 12:109296683-109296705 GACCCTCATGCCCCCAGGGGAGG + Intronic
1102238819 12:111310909-111310931 TACCCTGAGTGCCCCAGGAAGGG - Intronic
1102525578 12:113510277-113510299 CATCCTCAGCCCCACAGGATAGG + Intergenic
1103201344 12:119090543-119090565 TCCCCACATCCCACCAGGAGTGG + Intronic
1103905945 12:124327199-124327221 TACCCTCTGCCCCCCAGCCCCGG - Intronic
1104140783 12:125984129-125984151 TACACTAAGCCCCCCAGTAAAGG - Intergenic
1104750746 12:131236586-131236608 ACCCCTCAGCCTCCCAAGAGAGG - Intergenic
1111144843 13:84166693-84166715 TACCTGCAGACCCACAGGAGTGG - Intergenic
1111915108 13:94352377-94352399 TATCCTCAGCCCTCCAGCAATGG - Intronic
1112436503 13:99394505-99394527 TACTCACAGCTCCCAAGGAGAGG - Intergenic
1112561111 13:100514974-100514996 TTCCCACAGCCCTCCAAGAGCGG - Intronic
1113286256 13:108852221-108852243 TCCCCCCAGCCCCCCAGTAGGGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1118734463 14:68691600-68691622 AGCCCACAGCACCCCAGGAGGGG - Intronic
1120305278 14:82761922-82761944 TGCCCTCAACCCCCCAGCACAGG - Intergenic
1120931798 14:89856267-89856289 TACCCTCTGCCTCCCAGGTTTGG + Intronic
1122827422 14:104377012-104377034 TCCCCACAGCAGCCCAGGAGAGG - Intergenic
1122871177 14:104639736-104639758 AACCCTCAGCCCCCGAGGCCAGG - Intergenic
1122913310 14:104844197-104844219 TACCCCTAGTCCCCCAGGGGTGG + Intergenic
1122972089 14:105156499-105156521 TCCCCTCAGGCCCCCAAGACAGG + Intronic
1124227077 15:27903619-27903641 TGCCCTCCATCCCCCAGGAGCGG + Intronic
1128809173 15:70557599-70557621 TCACCTCAGCCTCCCAGCAGAGG + Intergenic
1128891652 15:71337294-71337316 TACCCTCGGTCCCCCTGGACTGG - Intronic
1129325442 15:74798076-74798098 TACCGTCAGCCTGCCAGGACTGG + Intronic
1130076802 15:80696115-80696137 GGCCCTCAGCCCCGGAGGAGGGG - Intronic
1130975302 15:88769235-88769257 TCTGCACAGCCCCCCAGGAGGGG - Intergenic
1132002488 15:98194053-98194075 TTCCCTGACCTCCCCAGGAGAGG + Intergenic
1132502892 16:292490-292512 TAGCCACAGCCTCCCTGGAGTGG + Intronic
1132887880 16:2190400-2190422 TGCCCTCAGGCCGCCTGGAGGGG - Intronic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1133980594 16:10630486-10630508 CTCCCTCCGCCTCCCAGGAGAGG + Intronic
1137592539 16:49702577-49702599 CACCCCCAGCCCTCAAGGAGAGG + Intronic
1137729240 16:50677621-50677643 TTCCCTCTGCCTGCCAGGAGGGG - Intronic
1138160059 16:54745096-54745118 CAACCTCAGACCCCCAGGACTGG - Intergenic
1140438589 16:74969026-74969048 CACCCTCAGCACACCAGGTGGGG + Intronic
1141365299 16:83437126-83437148 TGACATCAGCCTCCCAGGAGAGG + Intronic
1141767409 16:86067789-86067811 CAGCCTCAGACCCCCAGGGGTGG + Intergenic
1142644826 17:1304912-1304934 TACCCTCAGCACACCAGGCTGGG - Intergenic
1143674456 17:8421797-8421819 TACCCTCACCCTCCCAGGAGAGG + Intronic
1147650343 17:42058442-42058464 TAGCCTCAGCCTCCCTGGAATGG + Intronic
1148479227 17:47949331-47949353 CTCCCTCAACCCCCAAGGAGGGG + Intergenic
1150924742 17:69521170-69521192 TACCCCCAGTCCCCCATGGGTGG + Intronic
1152179169 17:78807146-78807168 GCCCCCCAGACCCCCAGGAGTGG - Exonic
1152573804 17:81131581-81131603 GACCCTCAGGCCCCAAGGTGGGG - Intronic
1155229480 18:23758556-23758578 TAGCCTCAGCCCCCAGGGAGAGG - Intronic
1159723223 18:71919555-71919577 TACCCTCACTCCCCAAAGAGTGG + Intergenic
1160622008 18:80178342-80178364 TCCCCTCAGCCCAGCAGCAGCGG - Intronic
1161389802 19:4015086-4015108 GACCCTGAGTCCCCCAGGACAGG - Intronic
1162016146 19:7847632-7847654 TCCTCTAAGACCCCCAGGAGGGG + Intronic
1162936387 19:13983649-13983671 AAGCCTGAGCCCCCCTGGAGGGG + Intronic
1163450300 19:17373239-17373261 TCACCTCAGCCCCCCAAGATGGG - Intronic
1165866394 19:38942091-38942113 CTTCCTCAGCCCCCCAGAAGGGG - Exonic
1166265800 19:41683567-41683589 GACCCTGAGCCTCCCAGGACAGG + Intronic
1166282989 19:41807571-41807593 GACCCTGAGCCTCCCAGGACAGG - Intronic
1166301321 19:41913486-41913508 GACCCGCAGCCGCCCAGGACGGG + Intronic
1166405886 19:42521705-42521727 GACCCTGAGCCTCCCAGGACAGG + Intronic
1167078649 19:47264586-47264608 TATCTTTATCCCCCCAGGAGTGG + Exonic
1167134617 19:47609335-47609357 CACACTCAGCCCCCCAGCCGGGG + Intronic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1167424401 19:49422623-49422645 CAGCCTCCGCCCCCCAGGACGGG - Exonic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
927251704 2:21000486-21000508 TTCACTCAGCCTGCCAGGAGTGG - Intergenic
927488979 2:23508053-23508075 TATTCTCAGCCTCCCAGCAGGGG + Intronic
929281853 2:40088263-40088285 CTCCCTCATCCCCCCAGCAGTGG - Intergenic
929587482 2:43125596-43125618 TACCCTCAGCTCTGCTGGAGGGG + Intergenic
932462565 2:71892527-71892549 AGCTCTCAGCCCCCAAGGAGGGG + Intergenic
932851760 2:75194427-75194449 TTCCCTCACCCCACCTGGAGGGG - Intronic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
935188609 2:100757334-100757356 TCCCCAAAGCCCACCAGGAGTGG + Intergenic
936525244 2:113236809-113236831 AGCCCTCATCTCCCCAGGAGAGG + Intronic
937325206 2:120986164-120986186 CACCCTCAGCCCCTCAGGGTGGG + Intronic
937992542 2:127672626-127672648 CCCGCTCAGCCACCCAGGAGAGG + Intronic
946318450 2:218932902-218932924 TGCCAACAGCCCCCCAGAAGAGG + Intergenic
947736307 2:232457255-232457277 CTGCCTCAGCCCGCCAGGAGGGG + Exonic
1168995839 20:2132585-2132607 AACTGTCAGTCCCCCAGGAGGGG + Intronic
1169189375 20:3648153-3648175 TGCCCTCTTTCCCCCAGGAGGGG + Exonic
1170402812 20:16006060-16006082 TACCCTTAGCCTTCCAGGATTGG - Intronic
1175381844 20:58569005-58569027 TTCCTTCTGCCACCCAGGAGAGG + Intergenic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1179243037 21:39608831-39608853 TTTCCTCAGCCCCCTGGGAGGGG + Intronic
1179628280 21:42660764-42660786 TGCACTCAGCCACCCAGGGGTGG + Intronic
1179631691 21:42682764-42682786 CACCCTCGGCCCCTCAAGAGCGG + Intronic
1181021886 22:20107891-20107913 TACCCTCCACCCCTCAGGAGTGG - Intronic
1181361100 22:22336745-22336767 GACCCCCAGCCCCCCCGGACAGG - Intergenic
1183740236 22:39664931-39664953 TTCCCCCATCCGCCCAGGAGGGG - Intronic
1184112272 22:42402333-42402355 CACCCTCAGGCCCCCACGTGGGG + Intronic
1184257216 22:43294197-43294219 CACCCCCGGCCCCCGAGGAGGGG + Intronic
1184566180 22:45293431-45293453 TACCCTCTGCCCCGCGGGTGGGG + Intronic
950006077 3:9691763-9691785 TCTCCTCAGCCTCCCAAGAGGGG - Intronic
950714505 3:14838120-14838142 GGCCCTCAGTCCCACAGGAGTGG - Intronic
950992732 3:17458232-17458254 AACCCTCAGCCCCTGAGGAAGGG - Intronic
952943182 3:38458630-38458652 TACCCTGAGCTCCCAAGCAGAGG - Intronic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
954375304 3:50191403-50191425 TCCCCGCAACCCTCCAGGAGAGG - Intergenic
954610290 3:51941568-51941590 TTCCCTCAGAACCCCAGGAATGG + Intronic
958936824 3:100264041-100264063 TCTCATCAGCCCCCCAGAAGAGG + Intronic
961134115 3:124494350-124494372 TCCCCACATCCCCCCAGAAGTGG + Intronic
961419928 3:126795052-126795074 AACCTGCAGCCCCTCAGGAGAGG - Intronic
961651745 3:128420426-128420448 AGCCCACAGCCTCCCAGGAGAGG + Intergenic
961696642 3:128709724-128709746 TGCCCTCTGCCTCCCTGGAGAGG - Intergenic
962842913 3:139251909-139251931 GACCCTCAGAGCCCCAGAAGAGG - Intronic
966762434 3:183429358-183429380 TACCCTCAGCCCCCTGTGATGGG - Intergenic
967989961 3:195123351-195123373 TTCCGTCAGCCGGCCAGGAGAGG - Intronic
968284980 3:197503206-197503228 CGCCCTCAGCCCCACAGGACTGG + Intergenic
969471066 4:7389637-7389659 CACCCTGTGCACCCCAGGAGGGG - Intronic
972014140 4:34223059-34223081 TAACCTCAGTCTCCCAAGAGAGG - Intergenic
978557241 4:109993882-109993904 CACCATCAGCACCCCAGAAGGGG + Intronic
978923705 4:114217325-114217347 TACACTCAGGCCCACAGCAGTGG - Intergenic
982388601 4:154839262-154839284 TTCCCTCAGCCCCCCATCACTGG - Intergenic
983627400 4:169815506-169815528 TACACTCAGCCCCGCAAGGGTGG - Intergenic
984712526 4:182897759-182897781 TCTCCTCAGCCCCGCAGGTGCGG - Intronic
985834528 5:2260876-2260898 CGCACTCAGCCCCTCAGGAGGGG + Intergenic
986752678 5:10803063-10803085 AACCATCAGCCTCCCAAGAGAGG - Intergenic
990479264 5:56192483-56192505 CCCTCTCTGCCCCCCAGGAGGGG + Intronic
992213783 5:74506233-74506255 TTTGCTCAGCCCCCCAGGGGAGG - Intergenic
997124441 5:131211868-131211890 CCACCTCAGCCCCCCAGTAGCGG - Intergenic
1001734650 5:173988770-173988792 TCCCTCCAGCCCCCCAGCAGTGG + Intronic
1004162094 6:13223419-13223441 TAAACTCAGTGCCCCAGGAGTGG + Intronic
1004229994 6:13823831-13823853 CACCCTCAGGCCCCAAGGAAAGG - Intergenic
1005755304 6:28920745-28920767 TACCCCCAGCCTCCCAGGCCAGG - Intronic
1013020788 6:106215351-106215373 TACCCTCACCCCTCAAGGAATGG + Intronic
1013188466 6:107782403-107782425 CACACTCAGCCCCCCGGGACCGG - Intronic
1015582150 6:134737173-134737195 GACCGTCATCCTCCCAGGAGTGG + Intergenic
1015600933 6:134909825-134909847 TACCTTCAGTCCCCCAGGGAAGG - Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1019061996 6:169263340-169263362 TGGCCTCAGCTCCCTAGGAGAGG - Intergenic
1019298116 7:289806-289828 TGCCCTGAGCGCCCCAGGAAGGG + Intergenic
1020347658 7:7182772-7182794 CCCTCTCCGCCCCCCAGGAGGGG + Exonic
1025095394 7:56092129-56092151 CCTCCTCAGCCCCCCAGGAAAGG - Intronic
1028583639 7:92432203-92432225 CAGCCTCTGCCCTCCAGGAGAGG + Intergenic
1032372210 7:131368104-131368126 TAACATCAGCCCCTCAGCAGTGG - Intronic
1034205495 7:149311087-149311109 TAGTCTCAGGCCTCCAGGAGAGG - Intergenic
1035068277 7:156123388-156123410 CTCCCTCCGCCTCCCAGGAGTGG + Intergenic
1036262209 8:7249893-7249915 TACCCACAGTCCTCCAGGTGCGG + Intergenic
1036304379 8:7589665-7589687 TACCCACAGTCCTCCAGGTGCGG - Intergenic
1036314248 8:7708432-7708454 TACCCACAGTCCTCCAGGTGCGG + Intergenic
1036355231 8:8037657-8037679 TACCCACAGTCCTCCAGGTGCGG - Intergenic
1036896541 8:12640691-12640713 TCCCCTCCTCCCCACAGGAGGGG + Intergenic
1037604116 8:20423029-20423051 GACCCTCCGCCTCCCAGGAAGGG + Intergenic
1039883850 8:41644497-41644519 GACCCCCAGACCCCCAGGATGGG - Intergenic
1040907201 8:52480895-52480917 TTCCTCCAGTCCCCCAGGAGAGG + Intergenic
1040947133 8:52895276-52895298 TACTCACAGCCGCCCCGGAGTGG - Intergenic
1042389129 8:68212976-68212998 TATCCTGAGGCCCCCAGGATGGG - Intronic
1045278531 8:100728408-100728430 TTGCCTCAGCCTCCCAGTAGTGG - Intergenic
1049021059 8:139957950-139957972 CACCCACAGCCCCTGAGGAGAGG + Intronic
1049443289 8:142618872-142618894 CGCCCTCAGCTCCTCAGGAGAGG + Intergenic
1049775619 8:144402782-144402804 TGCCGTCAGCCCCACATGAGTGG - Intronic
1051882560 9:21854738-21854760 TAACATCCGCCCCCCAGGTGCGG - Exonic
1056811835 9:89771133-89771155 TTCTCACAGCCACCCAGGAGAGG - Intergenic
1057171295 9:92964812-92964834 TACCCCCCGCCCCCCAGGCCTGG - Intronic
1057338516 9:94177934-94177956 TACCATCAGAGGCCCAGGAGGGG + Intergenic
1057836736 9:98451525-98451547 TCCCCACTGCCCCCCAGCAGTGG + Intronic
1059311613 9:113392123-113392145 TATCACCAGCCTCCCAGGAGTGG - Exonic
1060531203 9:124347896-124347918 TAACCTCAGCCCCACAGCTGTGG - Intronic
1060976189 9:127766523-127766545 AAACTTCAGCCCCCCAGGAGGGG - Intronic
1061184048 9:129041771-129041793 CACCCTCTGCCCCCCAGGCCTGG - Intronic
1061968609 9:134030999-134031021 CACCCTCAGCCCGCCAGCAAGGG + Exonic
1062387179 9:136317381-136317403 GACTCTCACCACCCCAGGAGAGG + Intergenic
1062408342 9:136408787-136408809 TGGCCCCAGCCCCCCAGGTGGGG + Intronic
1187562830 X:20418637-20418659 ACCCCACAGCCCCCAAGGAGAGG - Intergenic
1189274989 X:39778969-39778991 TGCCCCCAGCACCCCACGAGAGG + Intergenic
1195325667 X:103756323-103756345 CACCCCCAGCCTCCTAGGAGGGG - Intergenic
1198503691 X:137280209-137280231 TACCTTCTGCCCCACAGGACTGG + Intergenic
1200258946 X:154601400-154601422 TCCCCTGAGCACCCCTGGAGAGG - Intergenic