ID: 1017821095

View in Genome Browser
Species Human (GRCh38)
Location 6:158049542-158049564
Sequence GACCCTAAGCTGCTTCTTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 104}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017821095_1017821100 28 Left 1017821095 6:158049542-158049564 CCTAAAAGAAGCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1017821100 6:158049593-158049615 TCCAATAATACAACTTGTTTAGG 0: 1
1: 0
2: 0
3: 9
4: 148
1017821095_1017821103 30 Left 1017821095 6:158049542-158049564 CCTAAAAGAAGCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1017821103 6:158049595-158049617 CAATAATACAACTTGTTTAGGGG 0: 1
1: 0
2: 2
3: 16
4: 155
1017821095_1017821098 -7 Left 1017821095 6:158049542-158049564 CCTAAAAGAAGCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1017821098 6:158049558-158049580 TAGGGTCATGACTCAGGGAGAGG 0: 1
1: 0
2: 0
3: 15
4: 187
1017821095_1017821102 29 Left 1017821095 6:158049542-158049564 CCTAAAAGAAGCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1017821102 6:158049594-158049616 CCAATAATACAACTTGTTTAGGG No data
1017821095_1017821099 -4 Left 1017821095 6:158049542-158049564 CCTAAAAGAAGCAGCTTAGGGTC 0: 1
1: 0
2: 0
3: 11
4: 104
Right 1017821099 6:158049561-158049583 GGTCATGACTCAGGGAGAGGCGG 0: 1
1: 0
2: 1
3: 26
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017821095 Original CRISPR GACCCTAAGCTGCTTCTTTT AGG (reversed) Intronic
902254715 1:15180539-15180561 GACACTATGCTGATTGTTTTGGG + Intronic
902333692 1:15743037-15743059 GGCCCGAAGCCGCTCCTTTTCGG - Exonic
905584483 1:39105841-39105863 GGCCCTGAGCTGCTGCTTCTCGG + Intronic
906511826 1:46414392-46414414 GGCCCTGAGCTGCTGCTGTTTGG + Intergenic
908127530 1:61045754-61045776 AAACCTTAGCTACTTCTTTTTGG - Intronic
908471518 1:64448661-64448683 GATCGTAGGCTGCTTTTTTTTGG - Intergenic
915368372 1:155328128-155328150 GACCCTATGTCCCTTCTTTTAGG + Exonic
915664649 1:157433473-157433495 GAGCCCAGGCTGCTGCTTTTTGG + Intergenic
922698700 1:227745416-227745438 CACCCTAAGATGTTTCTATTCGG - Intronic
1070940338 10:80339751-80339773 GACCCTGAGCTGATTCGTTTTGG + Intronic
1071928536 10:90439146-90439168 GACCCTACCCTTCTTCTTTCTGG + Intergenic
1073166676 10:101460568-101460590 TACCCTAATGTGTTTCTTTTGGG - Intronic
1073548420 10:104373982-104374004 GACAATAAGCTTCTGCTTTTGGG + Intronic
1073553191 10:104422577-104422599 GGCCCAAAGCTGGTTCATTTGGG + Intronic
1074047040 10:109848699-109848721 GACTTTAAGATGCTTCTATTTGG - Intergenic
1074449734 10:113549415-113549437 GAGTCCAAGCTGCTGCTTTTAGG + Intergenic
1076468090 10:130699316-130699338 GAAGCTCAGCTGCTTCTTGTGGG + Intergenic
1077749266 11:4946387-4946409 AGCCTTAAGCTGCTCCTTTTTGG + Exonic
1079529959 11:21439602-21439624 GAGCCTAGGCTTCTGCTTTTGGG + Intronic
1079837989 11:25358836-25358858 AACCCTAAGCTGCTTCTAGTTGG - Intergenic
1083157243 11:60831430-60831452 GACACTAAGCTGGTACCTTTGGG + Intergenic
1083736381 11:64683836-64683858 GACCCTCGGCTGCTTCTTCCTGG - Intronic
1087702858 11:101456145-101456167 GAACCTAAACTGCCTCTCTTTGG - Intronic
1088206224 11:107396061-107396083 GACCCCAAGTTGCTCCATTTTGG + Intronic
1088811887 11:113397761-113397783 GGCCCTGAGCTGCCTCTTTCTGG + Intronic
1090181093 11:124700225-124700247 CACCCAAAGCTCTTTCTTTTGGG - Intergenic
1091674685 12:2480395-2480417 TACCCTATTCTGCTTCTTTAAGG + Intronic
1091874892 12:3925480-3925502 AACCCTAAGCAGCAGCTTTTGGG + Intergenic
1093416814 12:18929620-18929642 GAACATAAGCTGCTTCTGGTGGG - Intergenic
1099785977 12:87264511-87264533 GACCCAAAGCTGCTGGTTTGGGG + Intergenic
1100287306 12:93179587-93179609 GGCCTTATGCTGATTCTTTTTGG - Intergenic
1107580042 13:41773597-41773619 GACTCTTAGCTGCTTCTGTTTGG - Intronic
1107922432 13:45223065-45223087 CACCCTCAGCTGCTTTTTTAAGG - Intronic
1108463866 13:50695036-50695058 GATCCTGAGCTGATTCTCTTGGG - Intronic
1117429553 14:55642062-55642084 GAGCCTCAGCTTTTTCTTTTAGG + Intronic
1120080908 14:80215207-80215229 TGCCCTAGGCTGCTTCTCTTTGG - Intronic
1129922757 15:79334324-79334346 GACCAAAACCTTCTTCTTTTAGG - Intronic
1131239604 15:90727617-90727639 GTCTCTAACCAGCTTCTTTTGGG + Intronic
1131665821 15:94570145-94570167 CACCCTAAGCTTCCTTTTTTTGG + Intergenic
1134015746 16:10887124-10887146 GACCCCAAACAGCTTCTTTGTGG - Intronic
1141867080 16:86757748-86757770 GATCCTATCCTGCTACTTTTTGG - Intergenic
1142517728 17:443608-443630 GACCCTATGCTGCTTCTCACTGG - Intronic
1143009833 17:3860006-3860028 GAGCCATAGCTGCTGCTTTTGGG - Intergenic
1143663672 17:8343512-8343534 GACCCTACAATGCTTCTTCTTGG - Intronic
1144741736 17:17587130-17587152 CACCCAAAGCTGGTTCTTTGGGG + Intronic
1147560580 17:41506469-41506491 GACGCTAAGGTGCATTTTTTAGG + Intergenic
1148893897 17:50828817-50828839 TACCCTGAGCTGCCCCTTTTAGG - Intergenic
1149599069 17:57881687-57881709 AACCCCAAGCAGCTTCCTTTAGG - Intronic
1152539065 17:80965814-80965836 GCCCCTCCGCTGCTCCTTTTTGG + Exonic
1153686985 18:7556211-7556233 GACTCATAGATGCTTCTTTTGGG - Intergenic
1153777523 18:8466880-8466902 GACCCTAGGCCGCTTCCTTCAGG + Intergenic
1160781754 19:880488-880510 CACCCTAAGATGCCTCTCTTTGG - Intronic
1161224450 19:3136574-3136596 GAGCTGAAGCTGCTGCTTTTGGG + Exonic
1164835686 19:31353759-31353781 GACCTGAAGCAGCTTCATTTGGG - Intergenic
927021615 2:19022817-19022839 CACCCTGAGCTGCTTTCTTTTGG - Intergenic
927097599 2:19759406-19759428 GTCCCTAACCTGCTTCTTATTGG - Intergenic
927580743 2:24244192-24244214 GAAACTATGCTGCTTCTTTTTGG + Intronic
930027155 2:47035988-47036010 GAACCTAAGCGTCTTCTTTTGGG + Intronic
930721079 2:54639004-54639026 GACCCTAAGCTTCATAGTTTAGG - Intronic
933836587 2:86250832-86250854 GATCCTAATGTGCTTCTCTTTGG + Intronic
938639901 2:133266971-133266993 GATCCTAAGCAGCTTCTGATGGG - Intronic
938888117 2:135674509-135674531 GATCCTAAGAGGATTCTTTTAGG - Intronic
939959693 2:148555518-148555540 GACACTCAGCTGTTTCTTGTTGG - Intergenic
940736998 2:157464616-157464638 CACACTTAGCTACTTCTTTTGGG - Intronic
941591036 2:167420768-167420790 GCCCCAAAGCTGCTTTTTTGAGG + Intergenic
943219902 2:185091029-185091051 GACCTTCAGCCCCTTCTTTTTGG + Intergenic
943754014 2:191539336-191539358 TCCCCCAAGCTGCTGCTTTTAGG + Intergenic
947740357 2:232482032-232482054 GAACCTATCCAGCTTCTTTTAGG + Intronic
1175721120 20:61287907-61287929 GGCATTAAGCTGCTTCTGTTAGG + Intronic
1176948458 21:15013597-15013619 GACCTTATGCTGCTTATTTCTGG - Intronic
1181921238 22:26321991-26322013 GGCCCTGAGCTGCATCGTTTAGG + Intronic
1183363866 22:37397037-37397059 GAGCCTAAGCTCCTTCTTGGTGG + Intronic
1185197327 22:49480194-49480216 CACCGTAAGCTGCTTCTGTTTGG + Intronic
1185322872 22:50209878-50209900 GACCCTTCTCTGCTTCTTTGGGG + Intronic
949924294 3:9028737-9028759 CACCCTAAGTTGCTTTTCTTGGG + Intronic
951915502 3:27796969-27796991 GTGCCTCAGCTGCTTCCTTTAGG - Intergenic
952428900 3:33202964-33202986 GGTGCTAAGCTGCTTCTCTTTGG - Intronic
958798920 3:98733767-98733789 AACCCAAAGCACCTTCTTTTAGG + Intronic
959142917 3:102507387-102507409 GACCTTAATCTCCTTATTTTTGG - Intergenic
960974124 3:123158908-123158930 GAGTCTAAGCTGCTGCCTTTGGG + Intronic
971381991 4:26107593-26107615 GGCCCTCAGATGCTTCTCTTTGG + Intergenic
971726773 4:30324556-30324578 GATCCTGAGCTGCTTCTAGTTGG + Intergenic
973893887 4:55393796-55393818 CAGCCTAAGCTGCTCCTTTCAGG + Intergenic
974261966 4:59537089-59537111 GACCCTGAGCTCTTTCTTTCAGG + Intergenic
975311752 4:72911396-72911418 GAGCCTAAACTGCTTTTTATTGG + Intergenic
983368243 4:166823989-166824011 GTCCCTAAGCTGCTGCTTCCAGG + Intronic
984404230 4:179306631-179306653 GAGCCGATGCTGCTTCTCTTAGG + Intergenic
992595929 5:78347382-78347404 GCACCTAAGGTCCTTCTTTTGGG + Intergenic
999130742 5:149281372-149281394 GACGCTGAGCTGCATCTTTCAGG - Intronic
1008132463 6:47734429-47734451 GACACTAAGCTTATTGTTTTTGG + Intergenic
1013199700 6:107881468-107881490 GACCCTAGCCTGCCTCTCTTTGG + Intronic
1014433148 6:121392559-121392581 GACCCTAGGCTGGTCCTTGTGGG - Intergenic
1017821095 6:158049542-158049564 GACCCTAAGCTGCTTCTTTTAGG - Intronic
1021243165 7:18230178-18230200 GCCCCTAAGTTTCTTGTTTTAGG - Intronic
1021324510 7:19249241-19249263 GTCCCTCAGCTTCTTCTTGTTGG - Intergenic
1026177387 7:68009845-68009867 GACCTTCAGCTGCTTCCTTTGGG - Intergenic
1027816425 7:82977895-82977917 GACACTAAGGGGCTTATTTTTGG + Intronic
1032704177 7:134407816-134407838 GCTCCTTTGCTGCTTCTTTTGGG + Intergenic
1033547460 7:142414295-142414317 GGCCCTAAACTGCTCCTTCTTGG + Intergenic
1033588854 7:142794139-142794161 GCCCCTGAGCTGCTTCTTTCAGG + Intergenic
1035621219 8:1036879-1036901 AAACATAAGCTGCTTTTTTTAGG + Intergenic
1037862600 8:22416421-22416443 GACCCTAATCACCTTTTTTTTGG + Intronic
1041955389 8:63553650-63553672 GTCCCTTAGCTCCTTCATTTTGG - Intergenic
1042789768 8:72591298-72591320 GACACTGATCTGCTTCTTTCAGG + Intronic
1045507962 8:102791900-102791922 CGCCCTCAGCTGCTGCTTTTAGG + Intergenic
1047559378 8:125970108-125970130 GAGTCTAAACTGCTTTTTTTTGG + Intergenic
1048708857 8:137185597-137185619 GCCCCTAAGCTGTTTATTGTGGG - Intergenic
1048977353 8:139680386-139680408 GCCCCCAAGCTGCTACTTGTAGG - Intronic
1053512317 9:38698857-38698879 GACACTTTGCTGCTCCTTTTTGG + Intergenic
1054709140 9:68493577-68493599 GACTCTAAGATCCTTCTTTCAGG + Intronic
1055720527 9:79168075-79168097 GACCCTAACCTGGTTCTCATTGG - Intergenic
1192552374 X:72064696-72064718 GCCCCTGAGTTGCTTCTTTCGGG + Intergenic
1196739792 X:119014741-119014763 GACCAAAAGCTGCTGCTTTCAGG + Intronic
1197193580 X:123675994-123676016 GACCCTAAGCTTTCTCTTCTGGG - Intronic
1197712472 X:129681410-129681432 GACCCACAGCTGCTTCTTTAAGG - Intergenic
1199775724 X:151009703-151009725 GCCCCTCAGCTGCTTCTTCTCGG - Intergenic