ID: 1017822875

View in Genome Browser
Species Human (GRCh38)
Location 6:158061537-158061559
Sequence GAGGCTGGTGCGCGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 430}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017822863_1017822875 30 Left 1017822863 6:158061484-158061506 CCCACCTGGGCCACTTCAGCTGG 0: 1
1: 0
2: 8
3: 32
4: 265
Right 1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG 0: 1
1: 0
2: 3
3: 25
4: 430
1017822868_1017822875 20 Left 1017822868 6:158061494-158061516 CCACTTCAGCTGGAGACTTGGTC 0: 1
1: 0
2: 1
3: 12
4: 128
Right 1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG 0: 1
1: 0
2: 3
3: 25
4: 430
1017822865_1017822875 29 Left 1017822865 6:158061485-158061507 CCACCTGGGCCACTTCAGCTGGA 0: 1
1: 0
2: 2
3: 27
4: 209
Right 1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG 0: 1
1: 0
2: 3
3: 25
4: 430
1017822866_1017822875 26 Left 1017822866 6:158061488-158061510 CCTGGGCCACTTCAGCTGGAGAC 0: 1
1: 0
2: 2
3: 16
4: 181
Right 1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG 0: 1
1: 0
2: 3
3: 25
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017822875 Original CRISPR GAGGCTGGTGCGCGGCAGGA TGG Intronic
900092282 1:925647-925669 GAGGGTGGAGCGCGGGAGGAGGG + Intronic
900129115 1:1080161-1080183 GAGGCCGGTGCGGGGGAGCAGGG + Intergenic
900167320 1:1248896-1248918 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167343 1:1248962-1248984 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900167366 1:1249028-1249050 GAGGCTGGAGCGAGGGAGGCTGG + Intergenic
900550621 1:3252613-3252635 GGGGCTGGTGGGCAGCAGGGTGG + Intronic
900596886 1:3484014-3484036 GAGGAAGGTGTGCGGCAGGCTGG - Intergenic
900613284 1:3553405-3553427 GGGGCTGGTGGGGGGCGGGAGGG - Intronic
901629874 1:10642843-10642865 GCGGCAGGTGAGCGGCAGGCAGG - Exonic
902183820 1:14710449-14710471 GAGGCTGGTGAGAAGCTGGAGGG - Intronic
902815913 1:18916719-18916741 GAGGCTGGAGTGCGGCGGCATGG - Intronic
903597067 1:24502988-24503010 GAGCCTGGTGGGCGGCGGGCGGG - Exonic
905313140 1:37064489-37064511 AAGGCAGGTGAGAGGCAGGAGGG + Intergenic
905617088 1:39408855-39408877 GAGGCTGAGGCGCCGAAGGAGGG - Intronic
905651039 1:39657164-39657186 GAGGCTGGTCCCAGGGAGGAAGG - Intergenic
905790157 1:40785189-40785211 GAGCCTGGTGAGAGGGAGGAGGG - Intronic
908908543 1:69045680-69045702 GAGGGTGGAGGGTGGCAGGAAGG - Intergenic
909060670 1:70875614-70875636 GAGGCTGGAGGGTGGGAGGAAGG - Intronic
909289513 1:73864603-73864625 GAGGCTGGAGGGTGACAGGAGGG + Intergenic
911470831 1:98316285-98316307 CACGCTGGTGCGGGGCAGGCAGG - Intergenic
912595264 1:110869564-110869586 GAGGGTGGAGCGGGGAAGGAGGG + Intergenic
915098795 1:153483954-153483976 GAGGCTGGAGCCCGGCAGGCAGG - Intergenic
915973875 1:160372296-160372318 GAGTTTGGTGCGAGGGAGGAGGG - Exonic
916107482 1:161442017-161442039 GAGGCCGGTGGGAGGAAGGAGGG - Intergenic
916110654 1:161456816-161456838 GAGGCCGGTGGGAGGAAGGAGGG - Intergenic
916684989 1:167136244-167136266 GAGGCTGGGGTGGGGCAGAAGGG + Intergenic
918332126 1:183471462-183471484 GAGGCTGGCGGGCGGCGGGCTGG - Intergenic
919619468 1:199848627-199848649 GAGGCTGGTGGGCCTGAGGATGG - Intergenic
919695518 1:200570901-200570923 GAGGATGGTGGGTGGGAGGAAGG - Intronic
919858236 1:201720140-201720162 GAGGCCTGTGCTGGGCAGGAAGG + Intronic
919922317 1:202174036-202174058 CAGGCTGGTGGGGGGCAGGGTGG + Intergenic
922422827 1:225471127-225471149 GAGCCTGGTGCGAAGCAGGAAGG + Intergenic
923002293 1:230017310-230017332 GAGGCTGGAGGGCGGGAGGGGGG - Intergenic
1063465181 10:6238710-6238732 GAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1063593023 10:7410453-7410475 GAGGAAGGTGGGCGGCGGGAGGG + Intronic
1065368362 10:24956281-24956303 GAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1067265830 10:44744368-44744390 GAGGGTGGAGGGCGGAAGGAGGG - Intergenic
1067357367 10:45542300-45542322 CAGGCTGGAGTGCGGTAGGACGG - Intronic
1069052288 10:63808847-63808869 GAGGATGGAGGGTGGCAGGAGGG - Intergenic
1069157981 10:65053674-65053696 GAGGCTGGTGAGGGGCTTGAGGG - Intergenic
1072548284 10:96457289-96457311 GAGGCTGGGGTGCAGCAGGCTGG - Intronic
1072781157 10:98252735-98252757 GAGGCTGGTGCCTGACAGCAAGG + Intronic
1073028092 10:100503039-100503061 GAGGTTTGTGCACTGCAGGAAGG - Intronic
1073522867 10:104150879-104150901 GAGGGTGGTGGGTGGGAGGAGGG - Intronic
1074013660 10:109510170-109510192 GAGGGTGGCGGGTGGCAGGAGGG - Intergenic
1074510027 10:114103089-114103111 CTGGCTGATGTGCGGCAGGAAGG + Intergenic
1075087097 10:119421073-119421095 GAGCCTGGTGCGAGTCAGCAAGG - Intronic
1075098498 10:119489733-119489755 GAGGCTGGGACTGGGCAGGAAGG - Intergenic
1076300024 10:129418938-129418960 GAGCCTGGTGCGGGGCGGGGAGG - Intergenic
1076859610 10:133134456-133134478 GAGGCTGGGGGGCGGCTGGCAGG - Intergenic
1076911523 10:133392426-133392448 GAGGCTGGGGCTCGGGAGGGTGG - Intronic
1077159344 11:1105635-1105657 GAGGCAGGAGGGAGGCAGGAGGG - Intergenic
1077278924 11:1733233-1733255 GAGGCTGATGCGGGGCTGCACGG - Exonic
1078897509 11:15609993-15610015 GAGGCAGGGGCGAGGGAGGAGGG + Intergenic
1079920766 11:26431547-26431569 GAGGGTGGAGGGTGGCAGGAGGG - Intronic
1080147833 11:29009091-29009113 GAGGGTGGTGAGTGGGAGGAGGG - Intergenic
1080632406 11:34090573-34090595 GAGGCTGAGACGCAGCAGGAAGG - Exonic
1081848714 11:46260100-46260122 GAGGCTGCTGTGAGGCAAGAGGG + Intergenic
1082637840 11:55618361-55618383 GAGGATGGAGGGTGGCAGGAAGG - Intergenic
1082835312 11:57646918-57646940 TAGCCTGGTGCGCGAGAGGAGGG + Intronic
1083319740 11:61838438-61838460 GAGGCAGGGGCAGGGCAGGACGG + Intronic
1083714617 11:64568298-64568320 CAGGCTGGCGGGCAGCAGGAAGG + Intronic
1083822609 11:65181651-65181673 GGGGCTGGGGCGCGGCGGAAGGG - Exonic
1084332454 11:68438054-68438076 GTGGCTGGTGGGCGGCACCAGGG + Intronic
1084630091 11:70342252-70342274 GAGGCTGCTGCCCAGCAGGTGGG + Intronic
1084716007 11:70873844-70873866 GAGGCTGGTGCTAGGAATGAAGG - Intronic
1085894783 11:80625810-80625832 GAGGCTGGTCAGCAGCAGCATGG - Intergenic
1087325105 11:96711873-96711895 GAAGCTGGTACCCTGCAGGAGGG + Intergenic
1089499445 11:118923823-118923845 GAGGCTGGTGCCAGGAAGGAAGG - Intronic
1090271565 11:125389589-125389611 GAGGCTGGTGGGCCCAAGGAGGG - Intronic
1091241153 11:134053275-134053297 CAGGCTCGGGCGGGGCAGGAAGG + Intergenic
1091275734 11:134348434-134348456 GAGTCGGGTGGGCAGCAGGATGG + Intronic
1091690017 12:2589552-2589574 GAGGCCGGGGCAGGGCAGGAGGG + Intronic
1091789658 12:3264488-3264510 GTGGCTGGGGACCGGCAGGACGG + Intronic
1091801079 12:3324839-3324861 GAGGATGGGGCCGGGCAGGAGGG + Intergenic
1092002719 12:5044999-5045021 GAGGCTGGTGGGGCGCCGGAGGG - Exonic
1092291156 12:7160186-7160208 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291184 12:7160267-7160289 GAGGCAGGTGGGAGGCAGGCGGG - Intergenic
1092291204 12:7160324-7160346 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291208 12:7160335-7160357 GAGGCAGGTGGGAGGCAGGTGGG - Intergenic
1092291212 12:7160346-7160368 AAGGCAGGTGCGAGGCAGGTGGG - Intergenic
1092514152 12:9190494-9190516 GAGGGTGGAGGGCGGGAGGAGGG + Intronic
1093218488 12:16390439-16390461 GAGGGTGGAGGGTGGCAGGAGGG - Intronic
1093422332 12:18988669-18988691 GAGGCTGAGGTGAGGCAGGAGGG - Intergenic
1093554509 12:20454617-20454639 GAGGCTGGAGGGTGGGAGGAAGG - Intronic
1094653399 12:32399285-32399307 GAGGCAGTGGCGCGGCAGGGCGG + Intergenic
1095398955 12:41792595-41792617 GAGGGTGGTGGGTGGAAGGAGGG - Intergenic
1096229257 12:49888309-49888331 GAGGCTGGGGCTGGGCAGGATGG + Intronic
1096238057 12:49943155-49943177 GAGGCTAGGGAGGGGCAGGAAGG + Intergenic
1097990384 12:65826045-65826067 GAGCCTGGTTCCCCGCAGGACGG + Intronic
1099483353 12:83196209-83196231 GAGGCTGGTGGGCGGGGGGGGGG + Intergenic
1101000533 12:100353276-100353298 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1104221715 12:126790924-126790946 GAGGATGGAGGGCGGGAGGAGGG + Intergenic
1104946679 12:132417748-132417770 GAGGCTGGGCCGTGGGAGGAGGG - Intergenic
1105256949 13:18750078-18750100 GAGGGTGGTGGGTAGCAGGAAGG - Intergenic
1105259630 13:18769453-18769475 GAGGGTGGTGGGTAGCAGGAAGG - Intergenic
1105262306 13:18788770-18788792 GAGGGTGGTGGGTAGCAGGAAGG - Intergenic
1105453187 13:20518445-20518467 AAGGCTGGTGCTCTGCTGGAGGG + Intronic
1105943567 13:25171259-25171281 GGTGCTGGAGAGCGGCAGGAAGG - Exonic
1106197112 13:27503368-27503390 GAGGCTGGTGTCAGGCAGGAAGG + Intergenic
1107360003 13:39607582-39607604 GAGGATGGTGTGCCCCAGGAAGG + Intergenic
1108055647 13:46482380-46482402 GAGGCTGGTGCTCAGGAGAAAGG - Intergenic
1110431932 13:75434491-75434513 GAGGGTGGAGGGCGGGAGGAGGG + Intronic
1111091325 13:83452024-83452046 GAGGCTGGTGAGGGGCAGAGTGG - Intergenic
1112460255 13:99597811-99597833 GAGGGTGGAGGGTGGCAGGAGGG - Intergenic
1114057764 14:18988780-18988802 GAGGGTGGAGAGTGGCAGGAGGG - Intronic
1114059120 14:19002742-19002764 CAGGCTGGTGCGTGGCCGTAGGG - Intergenic
1114103422 14:19399012-19399034 CAGGCTGGTGCGTGGCCGTAGGG + Intergenic
1114104783 14:19412973-19412995 GAGGGTGGAGAGTGGCAGGAGGG + Intronic
1114667906 14:24391520-24391542 GAGGCTGGAGGGCTGAAGGAGGG - Intergenic
1115283256 14:31688806-31688828 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
1116243541 14:42379073-42379095 TAGGCTGGTGCGTGGCAGTGGGG - Intergenic
1116319728 14:43446355-43446377 GAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1117838631 14:59833676-59833698 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
1118680434 14:68236057-68236079 GAGGGTGGAGGGAGGCAGGAGGG + Intronic
1119055178 14:71412208-71412230 GTGGCTCGTGGGCTGCAGGATGG - Intronic
1119701902 14:76761481-76761503 GAGCCTGGTGGGCGGCTGGCTGG + Intergenic
1121755553 14:96399464-96399486 GAGGCTGGTGGCCAGCAGGGAGG - Intronic
1122338846 14:101011805-101011827 GAGGATGGTGCACAGAAGGAAGG - Intergenic
1122447663 14:101781478-101781500 GAGGCTGGGGGGCGGCAGGAGGG - Intronic
1122650340 14:103222541-103222563 GAGGCTGAGGTGGGGCAGGAGGG + Intergenic
1122814606 14:104306338-104306360 GAGGCTGGTGCGAGGGTGGGCGG + Intergenic
1122933065 14:104943596-104943618 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122933410 14:104945081-104945103 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122933874 14:104947061-104947083 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122933986 14:104947556-104947578 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122934218 14:104948546-104948568 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122934453 14:104949536-104949558 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122935276 14:104953001-104953023 CTGGATGGTGCGCGGCTGGAGGG - Exonic
1122977248 14:105175895-105175917 GAGGCTGGTGCTCAGCTGGTGGG + Intronic
1123497702 15:20845437-20845459 GAGGGTGGAGTGTGGCAGGAGGG + Intronic
1123554934 15:21419081-21419103 GAGGGTGGAGTGTGGCAGGAGGG + Intronic
1123591178 15:21856396-21856418 GAGGGTGGAGTGTGGCAGGAGGG + Intergenic
1123996370 15:25720632-25720654 GAGGCTGGTGGGAGGGAGGATGG + Intronic
1124652527 15:31484140-31484162 GTGGCTGGTGAGCAGCAGGCCGG + Exonic
1125238771 15:37549329-37549351 GAGGGTGGTGGACGGGAGGAGGG - Intergenic
1125408704 15:39382236-39382258 GAGGGTGGAGGGTGGCAGGAGGG + Intergenic
1127838947 15:62813061-62813083 GAGGCTGGAGATCGGAAGGAGGG + Intronic
1128470530 15:67948221-67948243 GAGGATGGAGGGTGGCAGGAGGG - Intergenic
1129206381 15:74039251-74039273 GAGGCTGGAGCTAGGCAGAAGGG + Intronic
1129872228 15:78947860-78947882 GAGGCTGGTGGGGGGGAGGCGGG - Intronic
1130024861 15:80262228-80262250 GAGGCTGGAGCACGGCAAGAAGG + Intergenic
1131314807 15:91326003-91326025 GAGGGTGGAGGGTGGCAGGAGGG - Intergenic
1202963278 15_KI270727v1_random:146274-146296 GAGGGTGGAGTGTGGCAGGAGGG + Intergenic
1133211846 16:4267637-4267659 GAGGCTGGAGCTGGGCAGGCAGG - Intronic
1133239292 16:4404969-4404991 CAGGCAGGTGCGGGGCAGGCGGG - Intronic
1134178797 16:12030921-12030943 AAGGCAGGGGCGTGGCAGGAGGG - Intronic
1134269522 16:12721463-12721485 GAGGCCGGGGCTGGGCAGGATGG + Intronic
1135709632 16:24704276-24704298 GAGACTGGTGGGGGGCGGGAGGG + Intergenic
1135862096 16:26065472-26065494 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
1136301741 16:29339403-29339425 GAGGCTGGTGAGTGTCAGGTGGG - Intergenic
1136522518 16:30806012-30806034 CAGGCTGGTGCTCGGGAGGGTGG - Intergenic
1137531664 16:49282049-49282071 GCGGGTGGCGCGCGGCAGCAGGG + Intergenic
1138281139 16:55773067-55773089 GAGGCGGGTGAGAGGAAGGAGGG + Intergenic
1138317977 16:56086767-56086789 GAGGCTGGTGTGTGGCAAGTGGG + Intergenic
1138752912 16:59445756-59445778 GAGGATGGAGGGCGGGAGGAGGG - Intergenic
1139520671 16:67481014-67481036 GGGACTGGTGCGCGGCCTGAAGG - Exonic
1142063431 16:88045962-88045984 GAGGCTGGTGAGTGCCAGGTGGG - Intronic
1142078101 16:88132010-88132032 GAAGCTGGGCAGCGGCAGGACGG + Intergenic
1142608932 17:1097125-1097147 GAGGCTCGTGGGTGGCAGGTGGG + Intronic
1142876059 17:2852922-2852944 GAGGCTCGCGCGCGGCTGGCAGG + Intronic
1142876292 17:2853643-2853665 GAGGCCGGGGCGCGGGAGGCGGG + Intronic
1142994210 17:3751342-3751364 GAGGCAGGTGGGTGGAAGGAGGG + Intronic
1143024039 17:3930479-3930501 GGGGCTGGTGGGTGGGAGGAGGG + Intronic
1143602393 17:7956743-7956765 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1144606237 17:16667376-16667398 GAGGCTGGTGAGGGGCTTGAGGG + Intergenic
1144650413 17:17003523-17003545 CTGGCTGGTGCGGGGCAAGAGGG - Intergenic
1145018396 17:19413147-19413169 GAGGGCGGGGCGGGGCAGGAGGG + Intronic
1145786484 17:27597203-27597225 GTGGCTGGTGGGAGGCAGGTGGG + Intronic
1145826209 17:27878949-27878971 GAGGAGGGGGCGGGGCAGGACGG + Exonic
1146225424 17:31062035-31062057 GGGGCAGGTGAGCAGCAGGAAGG + Intergenic
1146376533 17:32298397-32298419 GAGGGAGGTGTGTGGCAGGACGG + Intronic
1146884140 17:36459689-36459711 GATGCTGGTGAGCGGCAAGCAGG - Intergenic
1147738390 17:42655439-42655461 GGGACTGGTGCGGGGCAGGGAGG + Intergenic
1147944900 17:44075388-44075410 GAGGCTGGTGCCTAGCATGAGGG - Exonic
1148386980 17:47241159-47241181 GAAGCTGGTGAGTGGCAGGCTGG + Intergenic
1149172839 17:53833566-53833588 GAGGGTGGAGGGTGGCAGGAGGG - Intergenic
1149580275 17:57745136-57745158 GCGGGTGGTGGGAGGCAGGAGGG + Exonic
1149593796 17:57851372-57851394 GAGGCTGGTGAAGGGGAGGACGG + Intergenic
1149996405 17:61408253-61408275 GAGGCTAGTGCTAGGCGGGATGG - Exonic
1150225041 17:63519892-63519914 GAGGCTGGGGGGCAGGAGGAGGG + Intronic
1150286954 17:63960128-63960150 GCAGCTGGTGCCTGGCAGGAGGG - Intronic
1151478613 17:74357143-74357165 GAGGTAGTTGCGGGGCAGGAAGG + Exonic
1151677144 17:75604462-75604484 GAGGGAGGGGCGTGGCAGGAAGG - Intergenic
1151716002 17:75831345-75831367 GAGGCTGGGGCGGGGCCGGAGGG + Exonic
1151780189 17:76240392-76240414 GAGGATGGTGCGCGGCGCGCCGG - Intergenic
1152408246 17:80109418-80109440 GAGTCTGGTGTCCGGCACGATGG + Intergenic
1152758871 17:82098160-82098182 GAGGCTGGAGCGCGGCGGAGCGG + Exonic
1154274487 18:12947768-12947790 GAGGGTGGGGCGAGGCATGACGG + Intronic
1154426397 18:14275348-14275370 GAGGGTGGTGGGTAGCAGGAAGG + Intergenic
1154429137 18:14294944-14294966 GAGGGTGGTGGGTAGCAGGAAGG + Intergenic
1154431409 18:14311288-14311310 GAGGGTGGTGGGTAGCAGGAAGG + Intergenic
1154434087 18:14330592-14330614 GAGGGTGGTGGGTAGCAGGAAGG + Intergenic
1154455711 18:14521854-14521876 GAGGGTGGAGTGTGGCAGGAGGG + Intronic
1155059498 18:22216425-22216447 GAGGATGGTTTGCGGCAGGCAGG - Intergenic
1155304955 18:24469905-24469927 GAGGGTGGTGGGTGGGAGGAGGG - Intronic
1155497895 18:26460554-26460576 GAGGCTGGTGGACAGCTGGAAGG + Intronic
1156067866 18:33166921-33166943 GAGGGTGGAGGGAGGCAGGAGGG - Intronic
1156518614 18:37702159-37702181 GAGGCTGGTGGCAGACAGGAAGG + Intergenic
1157698158 18:49741210-49741232 GAGGGTGAAGCGTGGCAGGAGGG - Intergenic
1158095870 18:53770084-53770106 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1159084410 18:63772087-63772109 GAGGCTGGAGGGCGGGAGAAGGG + Intronic
1159475124 18:68911434-68911456 GAGGGTGGTGGGTGGGAGGATGG + Intronic
1159798231 18:72868215-72868237 GGGGCTGGTGCGCGGCAGAATGG + Intergenic
1160156448 18:76437336-76437358 GGGGCTGCTGGGCGGCAGGGAGG + Intronic
1160162106 18:76481141-76481163 GAGCCTGGTCAGAGGCAGGACGG + Intronic
1160317319 18:77859768-77859790 GAGGCTGGAGGGAGGCAGGTAGG + Intergenic
1160483507 18:79265054-79265076 GAGGCTGGAGGGTGGGAGGAGGG - Intronic
1160715877 19:576303-576325 GGGGCTGCTGCAGGGCAGGAAGG + Intronic
1160803032 19:979373-979395 CAGGATGGTGCGCGGGAGGCCGG - Intergenic
1161161181 19:2762626-2762648 GAGGCTGGAGAGCGCCAGGCTGG + Exonic
1162512587 19:11128526-11128548 GAGGCTGCAGCGAGGCATGATGG - Intronic
1163172780 19:15544053-15544075 GAGGCTGGAGGAGGGCAGGAAGG + Intronic
1163717017 19:18878701-18878723 GAGGCTGGGGAGGGGCAGGCAGG - Exonic
1164730967 19:30504302-30504324 GAGGCTGGTGGGAGGGAGGAAGG - Intronic
1165242722 19:34481235-34481257 GAGGCCGGTGCGCGGCCACATGG + Intergenic
1165912447 19:39237559-39237581 GAGGCTAGCCCACGGCAGGAGGG + Intergenic
1165913637 19:39244750-39244772 GAGGCTAGTCCATGGCAGGAGGG + Intronic
1165917325 19:39268874-39268896 GAGGCTAGTCCATGGCAGGAGGG - Intronic
1166979440 19:46624028-46624050 GAAGCTGGTGCCCAGCAGGTCGG + Exonic
1168378282 19:55899069-55899091 GAGGAGGGTGCGAGTCAGGAGGG + Intronic
1168383905 19:55946703-55946725 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1168563500 19:57403594-57403616 GGGGCTGGTGGAAGGCAGGAGGG - Intronic
1168722673 19:58562833-58562855 GAGGCTCGGGCGCACCAGGAGGG + Exonic
925343985 2:3157016-3157038 GACGATGGTGCGCGGATGGATGG - Intergenic
925856452 2:8134073-8134095 GAAGCTGGCGGGAGGCAGGAGGG - Intergenic
925862596 2:8194463-8194485 GAGGATGGTGGGAGGAAGGAAGG - Intergenic
926696235 2:15771645-15771667 TAGGCTGCTGTGAGGCAGGAAGG - Intergenic
927276517 2:21266897-21266919 TAGGCTGGAGCCCAGCAGGAAGG + Intergenic
927764929 2:25798170-25798192 GAGGGTGGTGTGGGGGAGGAGGG + Intronic
929075180 2:38074830-38074852 GCTGCTGGTGCGCGGCAGCGCGG - Exonic
929078959 2:38103586-38103608 GAGGGTGGAGTGTGGCAGGAAGG + Intronic
931539897 2:63318763-63318785 GAGGCTGGAGTGTGGGAGGAGGG + Intronic
931696723 2:64876486-64876508 GAGGCTGGGGAGTGGCAGGAGGG - Intergenic
932569891 2:72933065-72933087 GAGGCTGGAGCTGGGCAGGTGGG - Intronic
934493899 2:94781326-94781348 GAGGGTGGTGCGTAGTAGGAAGG - Intergenic
934568834 2:95355486-95355508 GAGGCTGGGGGGCTGGAGGAGGG - Intronic
935213280 2:100956355-100956377 GAGGCTGGAGGGAGGAAGGAAGG - Intronic
936083208 2:109449245-109449267 GAGGCTGGTGGCAGGCAGGCGGG - Exonic
937587128 2:123566443-123566465 GAGGGTGGAGGGTGGCAGGAGGG + Intergenic
938058280 2:128233190-128233212 GAGGCTGACGCGGGGCAGGGCGG - Intergenic
938475837 2:131612088-131612110 GAGGGAGGAGCGTGGCAGGAGGG - Intergenic
940207039 2:151214264-151214286 GAGGCTGGTGGGAGGCAGGTGGG + Intergenic
940384302 2:153052285-153052307 GAGATTGGTGCGCTGGAGGAAGG + Intergenic
941506858 2:166357104-166357126 GAGGGTGGAGGGTGGCAGGAGGG - Intronic
945833330 2:214810712-214810734 GAACTTGGGGCGCGGCAGGAAGG - Intergenic
946191327 2:218009610-218009632 GTGGCTGGGGGACGGCAGGAGGG - Intergenic
946228889 2:218279554-218279576 GAGGCTGGTGTTGGACAGGAGGG - Intronic
946733404 2:222730765-222730787 GGGGCTGGTGAACAGCAGGATGG - Intergenic
947536833 2:230945038-230945060 GAGGCTGGTGGGAGGAAGGAAGG - Intronic
947869789 2:233428183-233428205 GGGGCTGGAGCTCGCCAGGAGGG + Intronic
948172104 2:235912004-235912026 TCAGCTGGTGTGCGGCAGGAGGG + Intronic
948871183 2:240799056-240799078 GAGGCTGGGGCACTGTAGGATGG - Intronic
949079064 2:242082222-242082244 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1168742629 20:206063-206085 GAGGGTGGAGGGCGGGAGGAGGG + Intergenic
1169483339 20:6005784-6005806 GAGGCGGGTGGCCGGCAGAAGGG - Intergenic
1171227885 20:23456552-23456574 GAGGCTGGGCAGAGGCAGGAAGG - Intergenic
1171884084 20:30639241-30639263 GAGGGTGGTGGGCAGTAGGAAGG - Intergenic
1172705263 20:36878108-36878130 GTGGCTGGTGTAGGGCAGGAGGG - Intronic
1173819304 20:46010422-46010444 AAGGCTGGAGCGGGGCAGCAGGG - Intronic
1175011061 20:55736531-55736553 GAGGGTGGAGGGAGGCAGGAGGG + Intergenic
1175442749 20:59002707-59002729 CAGGCTGGGTGGCGGCAGGATGG - Intronic
1175927480 20:62477986-62478008 GAGGGTGCAGCGCGGCAGGCTGG + Intergenic
1176115375 20:63429778-63429800 GAGGCTGGTGGGGTGCAGGGAGG - Intronic
1176264186 20:64200127-64200149 GATGCTGGTGCGCCACATGATGG - Intronic
1176818455 21:13631485-13631507 GAGGGTGGAGTGTGGCAGGAGGG - Intronic
1178050482 21:28741541-28741563 GAGGGTTGTGGGTGGCAGGAGGG - Intergenic
1178416124 21:32406612-32406634 GTGCCTGGTGCCCGGAAGGAAGG + Intergenic
1178628422 21:34238296-34238318 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1178891717 21:36525625-36525647 CAAGCTGGTGAGCAGCAGGATGG + Intronic
1178955984 21:37022348-37022370 GAGGGTGGTGGGTGGAAGGAAGG - Intergenic
1179124176 21:38576887-38576909 GAGGCTGGAGCCTGGAAGGAGGG - Intronic
1179643522 21:42761903-42761925 GGGGCAGCTGAGCGGCAGGAGGG + Intronic
1179788844 21:43744026-43744048 GTGGCTGGTGTGAGACAGGAAGG + Intronic
1179798536 21:43799593-43799615 GAGGCTGGTGAGGAGCAGGCAGG + Exonic
1179929539 21:44558171-44558193 GAGGCAGGGGCACAGCAGGAGGG + Exonic
1179935534 21:44601597-44601619 GAGGTGGGGGCGCAGCAGGAGGG - Exonic
1180052165 21:45336168-45336190 ATGGCTGGAGCGCGCCAGGAGGG + Intergenic
1180085731 21:45507176-45507198 GAGGCGGGTGCTGGGCAGGGAGG + Intronic
1180090261 21:45530671-45530693 GCCGCTGGGGCGCAGCAGGAAGG + Intronic
1180261092 21:46669470-46669492 GACGCTGGAGAGCGGCAGCAGGG - Intergenic
1180476248 22:15711392-15711414 GAGGGTGGAGAGTGGCAGGAGGG - Intronic
1180649768 22:17368839-17368861 GAGGCTGGAGAGCGGCGGGAAGG - Intronic
1180970195 22:19811280-19811302 GGGGCTGGTACTGGGCAGGACGG - Intronic
1181112782 22:20611678-20611700 GAGGCTGCAGCGCTGCAGGGTGG - Intergenic
1181672080 22:24430379-24430401 GAGGCTGGTGGGCAGCAGGAAGG + Intronic
1184086940 22:42270809-42270831 GAGGCTGGCGCGCGCCGGGTAGG + Intronic
1184230783 22:43157283-43157305 GAGGGCGGGGCGGGGCAGGAGGG + Intronic
1184230792 22:43157301-43157323 GAGGGAGGGGCGGGGCAGGAGGG + Intronic
1184822619 22:46921230-46921252 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
1184987572 22:48146030-48146052 GAGGCAGGAGGGAGGCAGGAAGG - Intergenic
1184995997 22:48208070-48208092 GAGGCTGGTGTGACGCAGGCAGG - Intergenic
1185415429 22:50706704-50706726 GGGCCTCGAGCGCGGCAGGAGGG + Intergenic
949765624 3:7522706-7522728 CAGGCTGGTACGTGGCAGAATGG + Intronic
950610671 3:14124805-14124827 GAGGCAGGCGCGCGGCGGGCAGG - Exonic
953727355 3:45411835-45411857 GAGGGTGGTGGGTGGGAGGAGGG - Intronic
953842751 3:46402882-46402904 GAGACTGGAGGGCGGGAGGAGGG - Intergenic
954665473 3:52249119-52249141 GAGGCTGGTGGGAGTCGGGAAGG + Intronic
958460785 3:94392033-94392055 GAGGATGGTGGGTGGGAGGAAGG + Intergenic
959743889 3:109753778-109753800 GAGGGTGGAGCGTGGGAGGAGGG + Intergenic
960782686 3:121337095-121337117 GAGGGTGGTGGGTGGGAGGAGGG + Intronic
961213887 3:125144901-125144923 CAGCCTGGTGCTTGGCAGGAGGG - Intronic
961458978 3:127038328-127038350 GAGGCTGGTGGGAGACAGGTGGG - Intergenic
961645201 3:128389126-128389148 GAGGCTGGAGGGAGGCAGGCAGG + Intronic
962318492 3:134373311-134373333 AAGGCAGGGGAGCGGCAGGAAGG + Intronic
964134034 3:153324243-153324265 GAGGGTGGTGGGTGGGAGGAGGG - Intergenic
964209014 3:154208092-154208114 GAGGATGGTGGGTGGGAGGAGGG + Intronic
964743580 3:159990726-159990748 GAAGCTGGTGGGCAGCAGGAGGG - Intronic
966663500 3:182444013-182444035 GAGGATGGAGGGCGGGAGGAGGG + Intergenic
966941453 3:184750501-184750523 GAGGCTGCTGCCGGTCAGGATGG + Intergenic
967840909 3:194003780-194003802 GAGGCTGGAGCAGGGCAGGGAGG + Intergenic
968284767 3:197502070-197502092 GAGGCTGGGACGCGTCAGGGAGG - Intergenic
968944964 4:3658755-3658777 GAGCCTGGAGCAGGGCAGGATGG - Intergenic
969102438 4:4779165-4779187 GAGGCTGATGCGCTGAGGGATGG - Intergenic
969858913 4:10020809-10020831 GAGGCTGGTGAAGGGCAGGTGGG + Intronic
970574542 4:17414371-17414393 GAGGCTCGGGCGCGGGCGGAGGG + Intergenic
972989648 4:44808931-44808953 GAGGGTGGTGGGTGGGAGGAGGG - Intergenic
973163394 4:47046990-47047012 GAGGCTGGAGGGTGGCAGGAGGG + Intronic
973362555 4:49178450-49178472 GAAGCTGGTGGGAGCCAGGAAGG - Intergenic
975022668 4:69508703-69508725 GAGGCTGAAGAGCGGGAGGAGGG + Intronic
976914074 4:90348115-90348137 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
979279781 4:118852717-118852739 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
980817845 4:137971972-137971994 GAGGGTGGGGCGTGGAAGGAGGG - Intergenic
982024158 4:151235180-151235202 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
982690315 4:158540751-158540773 GTGGCTGCTGCGGGGCAGGGAGG - Intronic
983422969 4:167544015-167544037 GAAGCTGGTGAGAGGCATGAGGG - Intergenic
983522074 4:168719721-168719743 GAGGGTGGAGAGCGGGAGGAGGG - Intronic
984027902 4:174567094-174567116 GAGGGTGGAGGGTGGCAGGAGGG + Intergenic
985005927 4:185535439-185535461 GAGCCCGGTGGGCGGGAGGAAGG - Exonic
985085743 4:186310642-186310664 GAGACTGGGGGGCGGGAGGAGGG - Intergenic
987629665 5:20452606-20452628 GAGGGTGGAGGGTGGCAGGAGGG + Intronic
987939287 5:24511983-24512005 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
990823947 5:59875959-59875981 GAGGCTGGAGGGTGGGAGGAGGG + Intronic
991183183 5:63778187-63778209 GAGGCTGGAGGGTGGGAGGAAGG - Intergenic
993457362 5:88141724-88141746 GAGGCGGGGGCGGGGGAGGAGGG - Intergenic
994085300 5:95751678-95751700 GAGGGTGGTGGGAGGGAGGAGGG - Intronic
994215081 5:97128879-97128901 GAGGCTGGTTGGAGTCAGGAGGG - Intronic
997283166 5:132661189-132661211 GAGGCTGGTGGGTTGGAGGAGGG + Intergenic
999776587 5:154816916-154816938 CAGGCTGGGGCACGGCTGGATGG - Exonic
1000922976 5:167160368-167160390 GAGGCTGGAGCACAGCAGGCGGG - Intergenic
1001296772 5:170504156-170504178 GAGCCGAGTGTGCGGCAGGAGGG + Intronic
1001563181 5:172683476-172683498 GTGGCTGCTGGGCGGCAGGCAGG - Exonic
1002049564 5:176562426-176562448 GAGGCTGGAACTCGGGAGGAGGG + Intronic
1002424666 5:179168008-179168030 GAGGCTGGTCTGAGGCAGGAGGG - Intronic
1002805860 6:573387-573409 GAGGCAGGTGGGAGGCAGCAGGG - Intronic
1003093365 6:3122672-3122694 AAGGCGGGTGAGTGGCAGGAAGG + Intronic
1003737186 6:8889902-8889924 GAGGGTGGTGGGTGGGAGGAGGG + Intergenic
1003815706 6:9837762-9837784 GAGGGTGGAGGGCGGCAGGAGGG + Intronic
1004276735 6:14243287-14243309 GAGGGTGGTGGGTGGGAGGAGGG + Intergenic
1004591860 6:17059700-17059722 GGGGTTGGTGGGGGGCAGGAGGG - Intergenic
1005059691 6:21764159-21764181 GAGGCTGCTGCGAGCCAAGATGG - Intergenic
1005289149 6:24361272-24361294 GAGGGTGGAGCGTGGGAGGAGGG + Intergenic
1006646361 6:35517313-35517335 GAGGCTGAAGCGGGGAAGGATGG - Intergenic
1006796519 6:36735667-36735689 CAGGCTGGGGCTCTGCAGGAGGG + Intergenic
1006801235 6:36760887-36760909 GAGGCTGGTTTGGGGCAGGAAGG - Intronic
1007257806 6:40540928-40540950 GAGGCTGCTGGGGGTCAGGAGGG + Intronic
1007721757 6:43889372-43889394 GGGGCTGGGGGGTGGCAGGAAGG - Intergenic
1008547435 6:52595736-52595758 CAGGCGGGTGAGAGGCAGGATGG - Intergenic
1008737635 6:54565223-54565245 GAGGGTGGAGCGTGGGAGGATGG + Intergenic
1009247394 6:61256190-61256212 GAGGCTGGAGGGTGGGAGGAGGG - Intergenic
1009541175 6:64960798-64960820 GAGGGTGGTGGGTGGCAGTAGGG - Intronic
1009842178 6:69091639-69091661 GAGGCTGGCGGGTGGGAGGAGGG + Intronic
1011762783 6:90586710-90586732 GAGGCGGGGGCGGGGCAGGCCGG + Intronic
1013915147 6:115328386-115328408 GAGGCTGGAGCATGGGAGGAGGG - Intergenic
1014613762 6:123577289-123577311 GAGGGTGGAGGGTGGCAGGAGGG - Intronic
1014946578 6:127505517-127505539 GAGGATGGAGCGTGGGAGGAGGG + Intronic
1016733906 6:147455243-147455265 GAGGGTGGAGGGTGGCAGGAGGG + Intergenic
1017822875 6:158061537-158061559 GAGGCTGGTGCGCGGCAGGATGG + Intronic
1019047815 6:169161901-169161923 AAGGCTGGTGCTCAGCGGGAGGG - Intergenic
1019073813 6:169370842-169370864 GAGGCTGTGGAGGGGCAGGAGGG - Intergenic
1019363734 7:619683-619705 GAGCCAGGTGCCCTGCAGGAAGG - Intronic
1019412396 7:912016-912038 GACGATGGTGTGCGGCACGAGGG - Intronic
1020256136 7:6503971-6503993 GAGGGTGGGGCCTGGCAGGAAGG + Intronic
1021555796 7:21916397-21916419 GAGGCTGCGGCGAGGCATGAGGG - Intronic
1021969397 7:25951486-25951508 GAGGCTGGTGGGCAGAAGGGCGG - Intergenic
1023227592 7:37987211-37987233 GAAGATGGTGCCCAGCAGGAGGG - Intronic
1023313228 7:38909022-38909044 AAGGCAGGTCCGCGGCAGGGCGG - Intronic
1023358567 7:39392719-39392741 GAGGCTCAGGCGAGGCAGGACGG + Intronic
1024096287 7:45985374-45985396 GAGACTGGTGCGCTTCTGGATGG - Intergenic
1024323240 7:48089587-48089609 GAGGCGGGCGCGCGGCCGGGAGG + Intronic
1024563299 7:50662186-50662208 CAGGCTGGTGCATGGCAGGAGGG + Intronic
1024987870 7:55211767-55211789 GAGGCTGGTTAGCGACAGGGGGG - Intronic
1025211167 7:57020325-57020347 GGGGCTGGGGCGGGGCAGGGCGG - Intergenic
1025660788 7:63556522-63556544 GGGGCTGGGGCGGGGCAGGGCGG + Intergenic
1025689125 7:63744805-63744827 GAGGCTGCTGGGAGGCAGGTAGG - Intergenic
1025695827 7:63773819-63773841 GAGGCTGCTGGGAGGCAGGCAGG - Intergenic
1025912675 7:65840689-65840711 GAGGCTGCTGGGAGGCAGGCGGG - Intergenic
1027128279 7:75572823-75572845 GGGGCGGGTGCGGGGCAGCAGGG - Intronic
1027135849 7:75623448-75623470 GGGCCTGGTGCCCAGCAGGAGGG + Intronic
1029004320 7:97191685-97191707 GAGGGTGGGGAGTGGCAGGAGGG + Intergenic
1029250102 7:99230086-99230108 GAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1029465559 7:100722595-100722617 GGGGCTGCTGAGGGGCAGGAGGG + Intronic
1031922454 7:127612056-127612078 GAGTGTGGTGAGAGGCAGGAAGG + Intronic
1033967468 7:146993622-146993644 AAGGCTTGAGCGGGGCAGGAGGG - Intronic
1034359197 7:150479162-150479184 GAGGGTGGAGGGTGGCAGGAGGG + Exonic
1034997840 7:155589652-155589674 GAGGCTGGTGCCAGGCAGCACGG - Intergenic
1035520916 8:274405-274427 GAGGGTGGAGCCCTGCAGGAAGG + Intergenic
1035537325 8:402228-402250 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1035774537 8:2177991-2178013 GAGGGTGGTGGGCGGGAGGAGGG + Intergenic
1036032107 8:4985210-4985232 GAGGGTGGTGGGTGGGAGGAGGG + Intronic
1036176192 8:6540817-6540839 GAGGCAGGGGCGCCGCAGGGTGG + Intronic
1036755390 8:11467682-11467704 CAGGCAGGTGCGCGGCTGGTCGG + Intronic
1036773186 8:11592700-11592722 GAGGCAGGTGGCAGGCAGGATGG - Intergenic
1037323769 8:17668818-17668840 GAGGGTGGAGGGCGGGAGGAGGG - Intronic
1040083895 8:43318999-43319021 GAGGGTGGAGCATGGCAGGAGGG - Intergenic
1040407617 8:47121807-47121829 GAGGGTGGAGGGCAGCAGGAGGG + Intergenic
1040538205 8:48328233-48328255 GAGGCTGGAGGGTGGGAGGAAGG + Intergenic
1041220106 8:55642240-55642262 GAGGCTGGAGGGTGGGAGGAAGG - Intergenic
1043230887 8:77799750-77799772 GAGGGTGGAGGGTGGCAGGAGGG + Intergenic
1043493862 8:80778855-80778877 GAGGGTGGAGCGTGGAAGGAGGG + Intronic
1044067741 8:87719534-87719556 GAGGGTGGTGGGTGGAAGGAGGG + Intergenic
1044608939 8:94073087-94073109 GAGGCTTGTGCAAGGCATGATGG + Intergenic
1046137047 8:110041109-110041131 GAGGGTGGTGAGTGGAAGGAGGG - Intergenic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1049211231 8:141387291-141387313 GAGGCTGGAGCTCAGCAGGCAGG - Intergenic
1049326027 8:142022077-142022099 GAGGCGGGTGCCTGGCAGGGAGG - Intergenic
1049800237 8:144514275-144514297 GAGGCAGCTGTGCGGCTGGAGGG + Exonic
1050070780 9:1811068-1811090 GAGGGTGGAGAGCGGGAGGAGGG + Intergenic
1052632974 9:31064521-31064543 GAGGCTGGTGTTAGGGAGGATGG + Intergenic
1052669199 9:31534081-31534103 GAGGGTGGAGGGCGGGAGGAGGG - Intergenic
1053665534 9:40314901-40314923 GAGGGTGGTGGGTGGGAGGAAGG + Intronic
1053915117 9:42939948-42939970 GAGGGTGGTGGGTGGGAGGAAGG + Intergenic
1054376687 9:64454931-64454953 GAGGGTGGTGGGTGGGAGGAAGG + Intergenic
1054519080 9:66061383-66061405 GAGGGTGGTGGGTGGGAGGAAGG - Intergenic
1055874967 9:80931468-80931490 GAGGCTGGAGGGTGGGAGGAGGG + Intergenic
1057059610 9:91991784-91991806 GAGGCGGGTGGGGGGCAGGCTGG - Intergenic
1057161149 9:92889290-92889312 GAGGCTGGTGGGTAGTAGGAAGG - Intergenic
1057379677 9:94556162-94556184 GAGGGTGGTGAGCAGCAGTAGGG + Intergenic
1057704494 9:97387587-97387609 GAGGCTGGGGAGGGGCAGGGCGG - Intergenic
1058108911 9:101008044-101008066 GAGGCTGGAGAGTGACAGGAGGG + Intergenic
1060726032 9:126006519-126006541 GAGGCTGGTCCCCAGGAGGAAGG - Intergenic
1060799541 9:126535017-126535039 GAGGCTGGGGCGGGGCAGCCGGG - Intergenic
1060931368 9:127491501-127491523 CAGCCTGTTGCGAGGCAGGAGGG + Intronic
1061127970 9:128688975-128688997 GACACTGGCGCGCGGCAGGCCGG - Intronic
1061488773 9:130933930-130933952 GATGGGGGTGGGCGGCAGGAGGG - Intronic
1062008926 9:134256761-134256783 GAGCCTGGTGCTGGGCAGGAAGG + Intergenic
1062178325 9:135176586-135176608 GATGCTGGGGTGGGGCAGGAGGG - Intergenic
1062547630 9:137070776-137070798 GGGGCTGGGGCGGGGCAGAAAGG - Intergenic
1062658757 9:137617712-137617734 GAGGTGGGTGCGGGGCAGGAGGG + Intronic
1203528904 Un_GL000213v1:118022-118044 GAGGGTGGAGTGTGGCAGGAGGG + Intergenic
1185611255 X:1394848-1394870 GTGGCTGCTGGGCGGCGGGACGG + Intergenic
1186686368 X:11929102-11929124 GAGGGTGGAGCGTGGGAGGAAGG + Intergenic
1187184901 X:16974857-16974879 GAGGATGGAGGGTGGCAGGAGGG - Intronic
1187523768 X:20036134-20036156 GAGGGTGGAGCGTGGGAGGAGGG + Intronic
1187547417 X:20267153-20267175 GAGGTTGGGGCGCAGAAGGAGGG - Intergenic
1187820299 X:23280247-23280269 GAGGGTGGAGGGCGGGAGGAGGG + Intergenic
1189355398 X:40306596-40306618 GAGGCTGGAGTGCTGCAGTAGGG + Intergenic
1189377331 X:40475916-40475938 GAGGCAGGTGCGGGGCAGGGTGG - Intergenic
1192075783 X:67994712-67994734 GAGGGTGGAGGGAGGCAGGAGGG - Intergenic
1193947611 X:87757401-87757423 GAGGGTGGAGAGCGGGAGGAGGG - Intergenic
1197970143 X:132106871-132106893 GAGGGTGGAGTGTGGCAGGAGGG + Intronic
1198214526 X:134544838-134544860 GAAGCTGGTGAGAGGCAGAAGGG + Intergenic
1198736647 X:139792756-139792778 GAGGGTGGTGCGCCCAAGGAAGG + Intronic
1199310767 X:146317574-146317596 GAGGGTGGTGGGTGGGAGGAGGG - Intergenic
1199707737 X:150445314-150445336 GAGGGTGGTGGGTGGGAGGAAGG + Intronic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1200836356 Y:7735881-7735903 GAGGCTGAAGTGTGGCAGGAAGG + Intergenic
1201781469 Y:17727667-17727689 GAGGCTGCAGCGAGCCAGGATGG + Intergenic
1201820084 Y:18178323-18178345 GAGGCTGCAGCGAGCCAGGATGG - Intergenic