ID: 1017826682

View in Genome Browser
Species Human (GRCh38)
Location 6:158086862-158086884
Sequence GGACCTGGTGGAGCTCAAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 200}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017826671_1017826682 16 Left 1017826671 6:158086823-158086845 CCATTGTACTCATGCCCCGCCAT 0: 1
1: 0
2: 1
3: 6
4: 53
Right 1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 200
1017826678_1017826682 -9 Left 1017826678 6:158086848-158086870 CCTCCAGATGACGCGGACCTGGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 200
1017826672_1017826682 2 Left 1017826672 6:158086837-158086859 CCCCGCCATGTCCTCCAGATGAC 0: 1
1: 0
2: 1
3: 6
4: 104
Right 1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 200
1017826674_1017826682 0 Left 1017826674 6:158086839-158086861 CCGCCATGTCCTCCAGATGACGC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 200
1017826676_1017826682 -3 Left 1017826676 6:158086842-158086864 CCATGTCCTCCAGATGACGCGGA 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 200
1017826673_1017826682 1 Left 1017826673 6:158086838-158086860 CCCGCCATGTCCTCCAGATGACG 0: 1
1: 0
2: 1
3: 11
4: 123
Right 1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG 0: 1
1: 0
2: 1
3: 20
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017826682 Original CRISPR GGACCTGGTGGAGCTCAAGC GGG Exonic
900366447 1:2313733-2313755 GGTCTTGGTGGAGGGCAAGCAGG + Intergenic
900903360 1:5532616-5532638 GGTCCTGGTGGGGCTGAAGATGG + Intergenic
901048414 1:6413179-6413201 GGAGCTGCTGAAGCTTAAGCTGG + Intronic
901725861 1:11241566-11241588 GGAGCTGCTGGAGCCCATGCTGG - Exonic
902167323 1:14583178-14583200 AGACCTGGTGGAGGTCAACCAGG + Intergenic
903976766 1:27155059-27155081 GGACCAGGAGGAGCTGCAGCTGG - Intronic
904036978 1:27564217-27564239 GGCCCTGGAGGAGCTCAGACTGG - Intronic
907419498 1:54337301-54337323 GGACCTGGTGTTGCAGAAGCTGG + Intronic
911945878 1:104108270-104108292 GGACCAGGTGGAGGTCATGGGGG + Intergenic
912859358 1:113199134-113199156 CAACCAGGTGGAGGTCAAGCCGG + Intergenic
915428312 1:155845380-155845402 GGACCTGGTGGTGCAGAAGGTGG + Intronic
915980916 1:160419514-160419536 GGAGCTGGCGCAGCTCCAGCAGG - Exonic
917790035 1:178493566-178493588 GGGCCCGGTGGAGCACAAGGAGG + Intergenic
919945273 1:202314809-202314831 GGACCTGGATGAGCTCCAGCTGG + Exonic
920095530 1:203484060-203484082 GGGACAGGTGGAGCACAAGCAGG - Exonic
920735528 1:208529814-208529836 GGTCCTGGGGGAGCCCATGCTGG - Intergenic
923023466 1:230185759-230185781 GGATCTGGTAGAGCTCCAGGAGG + Intronic
923332175 1:232935341-232935363 GGGCCTGGAGGAGCTGAAGGAGG - Intergenic
1063842632 10:10089354-10089376 GGACCTGGTCGAGCTCCTGGAGG + Intergenic
1064327742 10:14366466-14366488 GGAGTTTGTGGAGCTCAAGAGGG + Intronic
1065540702 10:26763918-26763940 GGTGCTGGTGGAGCTCCAGAAGG + Exonic
1066421872 10:35271405-35271427 GGACCTGGTAGAGCTCTGGGAGG - Intronic
1067081904 10:43216883-43216905 GGTCCTGATGGAGCTCAGGAGGG - Intronic
1070290231 10:75109070-75109092 GGAGCTGGAGGAGCTCCTGCGGG - Exonic
1070916614 10:80159106-80159128 GGACCTGGAGGAGGGCATGCTGG - Exonic
1072692934 10:97583593-97583615 GGACCTGGTGCAGCTCTGGCAGG + Exonic
1076255960 10:129025220-129025242 GGACCTGGAGGAGCGGAGGCAGG + Intergenic
1081543349 11:44051921-44051943 AGACATGGTGGACCTCAAGGAGG + Intronic
1083746028 11:64736899-64736921 GGACCTGGTGGCCCTGCAGCTGG - Exonic
1084181828 11:67450776-67450798 GGCCCTGGTGAACCACAAGCTGG - Intergenic
1085011790 11:73146474-73146496 GGACTTGGTGGGGCCCAGGCAGG - Intergenic
1086948432 11:92867109-92867131 GGGCCTGACGGAGCTGAAGCTGG + Exonic
1089518601 11:119049137-119049159 GGAGCAGGTGGAGCTCAAGGAGG - Exonic
1091371745 11:135066162-135066184 GGCCCTGGTGAAGCTCACGGAGG - Intergenic
1091923503 12:4324482-4324504 CAACCAGGTGGAGATCAAGCCGG - Intronic
1093623788 12:21322967-21322989 GGACAGGGTGGATCTCAAGCAGG - Intronic
1096457438 12:51799253-51799275 GGACCTGCTCGAGCCCAATCAGG + Intronic
1097035583 12:56121562-56121584 GGAGCAGCTGGAGCTCCAGCAGG - Exonic
1102956231 12:117060837-117060859 GGACCACGTGGAGCTCCAGAGGG + Intronic
1104382321 12:128318057-128318079 GGACCTGTTGGATGTCAGGCTGG + Intronic
1105281370 13:18964625-18964647 AGACCTGCTGGAGCTGGAGCTGG - Intergenic
1105788248 13:23770597-23770619 GCACCTGGGGGAGGCCAAGCTGG - Intronic
1112068815 13:95825270-95825292 GAACCTGTTGTAGCTAAAGCAGG + Intronic
1113803071 13:113096442-113096464 GGACGTGGTGGAGCTGGTGCAGG + Exonic
1114646528 14:24259380-24259402 GGGCTGGGTGGAGCTCAGGCTGG - Intronic
1117160002 14:52979910-52979932 GCACCTTGGGGAGCTGAAGCTGG - Intergenic
1118618790 14:67595791-67595813 GGACCAGGTGGAGGACAAGTAGG + Intronic
1123048335 14:105528915-105528937 GTACCTGGTGGAGCAGAACCAGG + Exonic
1124092963 15:26623681-26623703 GGACCTGGGGCAGTTTAAGCGGG - Intronic
1125461418 15:39910444-39910466 GGGCCTGGTGGGGCTGAGGCAGG + Intronic
1126311298 15:47319791-47319813 AAACCTGGTTGAGCTCATGCAGG + Intronic
1128345245 15:66849118-66849140 GCACCTGGTGGAGGTGGAGCTGG - Intergenic
1128447363 15:67775887-67775909 TGACCTGGTGGAGTTCAAACAGG + Intronic
1129016689 15:72474774-72474796 GGAGCTGGTGGAGCCCGGGCTGG + Exonic
1129874024 15:78960555-78960577 GGACCGGGTGGTGCTCTAGTTGG - Exonic
1132704481 16:1237190-1237212 GGAGCTGGAGGGGCTCATGCAGG + Intergenic
1132707033 16:1249235-1249257 GGAGCTGGAGGGGCTCATGCAGG - Intergenic
1132920510 16:2387753-2387775 GTACCTTGTGGGGCTGAAGCAGG + Intergenic
1132981421 16:2740274-2740296 GGACCTGCTGTAGGACAAGCTGG + Intergenic
1133332270 16:4982123-4982145 GGCCCTGGTGGAGGACAGGCAGG + Intronic
1134186662 16:12090106-12090128 GGAAGTGGTGGAGCTGAGGCTGG - Exonic
1134272649 16:12746908-12746930 GGGCCAGGTGGAACTCAAGTGGG + Intronic
1135684753 16:24489890-24489912 GGACCAGGTGGAGCTCACATAGG - Intergenic
1136508330 16:30720792-30720814 GGACCTGGAGGAGGTCGAACTGG - Exonic
1138890079 16:61131054-61131076 GGACCTAGTAGAGCTCCCGCAGG + Intergenic
1138907464 16:61354426-61354448 GAACCTGGTAGAGCTCCAGGAGG - Intergenic
1139923475 16:70473441-70473463 GGACCATGAGGTGCTCAAGCAGG + Intronic
1140753664 16:78048552-78048574 GGCCTTGGTGGAGCTGGAGCCGG + Intronic
1142400568 16:89856169-89856191 GATCCTGGAGGAGATCAAGCAGG + Exonic
1142983008 17:3682154-3682176 GTCCATGGTGGAGCTCAAGCTGG + Intronic
1143717146 17:8782235-8782257 GAACCTGGTAGAGCTCCAGGAGG - Intergenic
1144937698 17:18913357-18913379 GGACCTGCTTGAGCTATAGCTGG + Intronic
1145882916 17:28364961-28364983 GGCCATGGTGGGGGTCAAGCTGG + Intronic
1146184749 17:30717499-30717521 GGGCCTTGTGGACCTCAAGGAGG - Intergenic
1146657233 17:34641810-34641832 GACCCTCGTGGAGTTCAAGCGGG + Intergenic
1147636730 17:41968499-41968521 GGTGCTGGTGGAGCCCAAGACGG + Exonic
1151669684 17:75565194-75565216 GGTCCTGCTGGAGCTCCAGGAGG - Intronic
1152067129 17:78117991-78118013 AGCCCTGGGGGAGCTCAAGAGGG + Intronic
1159849837 18:73514724-73514746 GGACCAGGTGTACCACAAGCAGG + Intergenic
1160845721 19:1165192-1165214 TGACCTGGTGGAGCTCCTGACGG - Intronic
1160976875 19:1797025-1797047 GGGCCTGTGGGAGCTGAAGCAGG - Intronic
1161156319 19:2733473-2733495 GGACCTTCTGGAGCTGCAGCCGG + Exonic
1161619193 19:5289522-5289544 GGACCTGGTGGGCCTCAGGAAGG - Intronic
1161895363 19:7075559-7075581 GGACCTGGTCGATCGCAGGCAGG + Intronic
1162131771 19:8530396-8530418 GGACCTGGAGGAGCTGTATCAGG - Intronic
1165065395 19:33225589-33225611 GGAGCGGGTGGCGCTCAAGAAGG - Exonic
1165398128 19:35578651-35578673 GGTCCTGGTGGGGCCCAGGCAGG - Intergenic
1165812024 19:38617583-38617605 GGACCTGGTGGCACTGAAGATGG - Exonic
1165993037 19:39826846-39826868 GGACCTGGTGCTGCGCATGCTGG - Exonic
1166315740 19:41988487-41988509 GGACCTGGATGACCTCAAGAAGG - Exonic
1166734691 19:45077078-45077100 GGGCATGGTGGAGCTGAGGCTGG + Intergenic
1168643683 19:58046305-58046327 GGACTTGCAGGAGCTCAAGAAGG + Intronic
926139911 2:10362411-10362433 GGACATGGAGGAGCTCAGGCTGG - Intronic
928453019 2:31395551-31395573 GGACCTGGTGGAGATCCTGGAGG + Intronic
930523895 2:52501977-52501999 GAACCTGGTAGAGCTCATGAAGG - Intergenic
931250921 2:60529891-60529913 GGAGCTGCTGGGGCTAAAGCTGG - Intronic
935165768 2:100567510-100567532 GGACCTGAAGGAGGTGAAGCTGG + Intronic
935519099 2:104082019-104082041 GGACCTGGTAGAGCTCATGGAGG + Intergenic
936288362 2:111199083-111199105 GGGCCAGGTGGGACTCAAGCCGG + Intergenic
936953401 2:118000859-118000881 GGATCTGGTGGGGCTCCAGCTGG + Exonic
940868971 2:158844089-158844111 GAACCTGGTTGACCTCCAGCAGG + Intronic
942792444 2:179776054-179776076 GGAACTGTTGAAGCTCAAACTGG + Intronic
943663402 2:190583666-190583688 GGACTTGGTAGAGCTCAACCAGG + Intergenic
944772238 2:202925998-202926020 GGAGCTGGTGCAGCTGAAGGAGG - Intronic
945223392 2:207507173-207507195 GGACTCAGTGGAGCTCATGCTGG - Intergenic
945313136 2:208339442-208339464 AGAACTGGTGGAGCTCTGGCTGG - Exonic
946308596 2:218870556-218870578 GGTCCTAGTGGACCACAAGCTGG - Intronic
948468462 2:238163199-238163221 GCACCAGGTGGAGCTCAGCCTGG + Intronic
948527954 2:238584722-238584744 GAACCTGGTGGAGCTCCTGGAGG + Intergenic
948942200 2:241202241-241202263 GCAGCTGGTGGATCCCAAGCAGG - Exonic
1169250381 20:4056150-4056172 GGACCTGGTGGGGCTGGAGGGGG + Intergenic
1169422774 20:5473222-5473244 GGTCCTGGTGGAGCTCTTCCAGG + Intergenic
1170721371 20:18882587-18882609 GAACCTGATAGAGCTCCAGCAGG + Intergenic
1172447289 20:34999829-34999851 TGACCTGGGAGAGCTCCAGCTGG - Exonic
1172760340 20:37317006-37317028 GCACCTGATGGAGCAGAAGCAGG - Exonic
1175277549 20:57782564-57782586 GGCCATGGTGGAGCTCAGGAAGG - Intergenic
1175583974 20:60122699-60122721 GGACCTGGAGGAGCAGAGGCTGG - Intergenic
1175722373 20:61294916-61294938 GGGCCTGGTGGAGCTCGGGTGGG - Intronic
1175773266 20:61636888-61636910 GGCCCTGGTGCAGCTCAGGGAGG - Intronic
1176147086 20:63570363-63570385 GGACCTGCTGCAGGTCACGCAGG + Intronic
1176220507 20:63967344-63967366 GGCCATGGTGGGGCTCATGCTGG - Intronic
1179912413 21:44457109-44457131 GGCCCTGTGGGAGCTGAAGCTGG + Exonic
1180254943 21:46620433-46620455 GGACCTGGTCGAGCTCCTGGAGG + Intergenic
1181171266 22:21011564-21011586 GGACCTGTTGGAGAACCAGCTGG - Intronic
1181319151 22:21991393-21991415 GGGGCTGATGGAGCTGAAGCAGG - Intergenic
1181601988 22:23958284-23958306 GGCCCTGGAGGAGCTGATGCAGG - Exonic
1181606521 22:23983023-23983045 GGCCCTGGAGGAGCTGATGCAGG + Exonic
1182144639 22:27989995-27990017 GCACCTGGTGGAGCTGAGGAAGG + Exonic
1182760459 22:32718285-32718307 GGACTTGGTGGAGCAGAATCTGG - Intronic
1183273464 22:36876291-36876313 GGAACTGGTTGAGCTCACGCAGG + Intronic
1183589312 22:38770576-38770598 GGACCCTGTGGAGCTGAAGAAGG - Intronic
1185270122 22:49925925-49925947 GGAAGTGGTGGAGGGCAAGCGGG + Intronic
949321666 3:2818107-2818129 CGTCCTGTTGGGGCTCAAGCAGG - Intronic
950455777 3:13091941-13091963 GGACCTGGAGGCGCTGGAGCAGG + Intergenic
952289823 3:32004284-32004306 GGACCTGGAGGGCCTCCAGCAGG + Intronic
953026560 3:39148504-39148526 GGTCCTGGGGGATCTCAGGCTGG - Intronic
954112261 3:48440637-48440659 GGGCCGAATGGAGCTCAAGCTGG + Intronic
954374177 3:50185489-50185511 GGAGTTGGAGGAGCTCATGCTGG + Exonic
955251106 3:57283299-57283321 GGACATGGTGAAGCTTATGCTGG - Exonic
957091211 3:75732059-75732081 GAGCCTGGTGGAGCTCCAGGAGG - Intronic
957696811 3:83649855-83649877 GGACTTGCTGGAGCTCCTGCAGG + Intergenic
959606828 3:108250203-108250225 GGACCAGATGGACCTGAAGCAGG + Intergenic
959682818 3:109115765-109115787 GGATGTCCTGGAGCTCAAGCTGG + Intronic
960856808 3:122109758-122109780 GGACCTGGTGGTGTTTAAGCAGG + Intronic
962312493 3:134336562-134336584 TGCCTTGGAGGAGCTCAAGCTGG - Intergenic
963042616 3:141080644-141080666 TGGGGTGGTGGAGCTCAAGCTGG + Intronic
964072305 3:152649582-152649604 AGACCTGGGGGAGCTTAAGCTGG - Intergenic
966451891 3:180072875-180072897 GAACCTGGTGAAGCTCCAGGAGG - Intergenic
967891186 3:194365692-194365714 GGACCTGCTGGACCTCCAGCAGG + Intronic
967891188 3:194365695-194365717 GGCCCTGCTGGAGGTCCAGCAGG - Intronic
969501042 4:7553160-7553182 GGACCTTGTGGATCTCAGGCTGG - Intronic
974023696 4:56713133-56713155 GAACTGGGTGGAGCTCAAGGAGG + Intergenic
975581308 4:75909334-75909356 GGACTTTGTGGGGCTGAAGCGGG - Intergenic
977182704 4:93897328-93897350 AGCCCTGGTAGAGCTCAAGAGGG + Intergenic
979036132 4:115720762-115720784 GAACCTGGTGGAGCTCCTGAAGG + Intergenic
981359030 4:143826256-143826278 GGACCTGGTGCAGTTCCAGGTGG + Intergenic
981369813 4:143947155-143947177 GGACCTGGTGCAGTTCCAGGTGG + Intergenic
981379552 4:144057116-144057138 GGACCTGGTGCAGTTCCAGGTGG + Intergenic
982345454 4:154352840-154352862 TGACCTTGTGGAGCTCATGGAGG + Intronic
983366668 4:166799739-166799761 GGACTTGTTGGAACTGAAGCAGG + Intronic
984954478 4:185031836-185031858 GGAGCTGGTGGAAATCAAGAGGG + Intergenic
985881913 5:2644798-2644820 AGAGCGGGTGGAGCTCATGCTGG - Intergenic
988068208 5:26250750-26250772 GGACCTGGTTGAGCCACAGCTGG + Intergenic
992177658 5:74166328-74166350 GGCCCTGATAGATCTCAAGCAGG + Intergenic
994723544 5:103408116-103408138 GGACCTGAAGGAGCTCAAAGAGG - Intergenic
997239298 5:132294925-132294947 GGACCTGGGGCAGCTGGAGCAGG + Exonic
997248368 5:132370281-132370303 GGACCTGGGGCAGCTGGAGCAGG + Exonic
1000712744 5:164601112-164601134 CAACCAGGTGGAGATCAAGCTGG - Intergenic
1001450472 5:171820689-171820711 GGACCTGCTGTTGCTCAATCTGG - Intergenic
1001550999 5:172602379-172602401 GTAACAGGAGGAGCTCAAGCAGG - Intergenic
1002315792 5:178342222-178342244 AGACCTGCTGGAGCTCCAGGTGG - Intronic
1002384353 5:178855188-178855210 GAACCTGGCTGAGCTCCAGCAGG + Intergenic
1002569830 5:180134042-180134064 GGATCTGGGTGGGCTCAAGCTGG + Intronic
1006377381 6:33679023-33679045 GGGCCTGATAGAACTCAAGCAGG + Intronic
1006841667 6:37032305-37032327 GGGCCTGGTGGAGCACACGGAGG - Intergenic
1007482994 6:42162490-42162512 AGCCCTGGTGGAGGGCAAGCTGG + Intronic
1007775281 6:44221586-44221608 GGACCTGAGGGAGCTCAGGGAGG + Intronic
1007790498 6:44305715-44305737 GGACATGGTAGAGCTGATGCTGG - Exonic
1008090211 6:47286085-47286107 GAACCTGGTGGTGATCAAGCCGG - Exonic
1015313644 6:131793029-131793051 CTACCTGGTGCAGCTCAACCTGG + Intergenic
1016209434 6:141510398-141510420 GGACCTGGAGAAGCTGAAGCAGG - Intergenic
1017826682 6:158086862-158086884 GGACCTGGTGGAGCTCAAGCGGG + Exonic
1019713276 7:2526976-2526998 GGGCCTCGTGGAGCTGCAGCAGG + Intronic
1022273078 7:28829410-28829432 GTAGCTAGTGGAGCTCAACCAGG + Intergenic
1022427229 7:30280857-30280879 TGAAGTGGTTGAGCTCAAGCTGG - Intergenic
1023691457 7:42793151-42793173 TAAACTGGTGGAGCTCTAGCAGG - Intergenic
1026644602 7:72156623-72156645 GAGCTTGGTGCAGCTCAAGCTGG + Intronic
1026934357 7:74244509-74244531 GGACATGGTGGCGCCCAGGCTGG - Intronic
1027171394 7:75875392-75875414 GGAGCTGGTGGAGCTCAGGCTGG - Intronic
1029482119 7:100819680-100819702 GGACCTGGTGGAGCCCTGGGTGG - Exonic
1034542218 7:151765546-151765568 GGAGCTGGTGGAGCTGAGACGGG - Intronic
1035570979 8:671967-671989 GGACCTGGTGGAGCCCAGAGAGG - Intronic
1035690512 8:1556619-1556641 GGAGCTGTTGGAGCTCAGGCCGG + Intronic
1036065714 8:5379594-5379616 GGACCTGGTAGAGTACAAGATGG - Intergenic
1038840232 8:31177829-31177851 GGTCCTGGTGGAGCTCCAGTGGG - Intergenic
1040131590 8:43803155-43803177 GGACATTGGGGAGCTCAAGGAGG + Intergenic
1042778266 8:72460126-72460148 GGACCTGGTGGAGCTCTTTTAGG + Intergenic
1043839235 8:85082774-85082796 GGACCTGGTAGAGCTCCTGGTGG + Intergenic
1045620382 8:103970496-103970518 GAACCTGGTGGAGCTCCTGGAGG + Intronic
1046034213 8:108821644-108821666 GGGCCTGTTGGAGCTACAGCTGG - Intergenic
1046502260 8:115093781-115093803 GGACCTGGTAGAACTCCTGCAGG + Intergenic
1046770621 8:118112959-118112981 GGACCTGGAGGATCTTTAGCGGG - Intergenic
1047751076 8:127881015-127881037 GTACCTTGCAGAGCTCAAGCAGG + Intergenic
1050326155 9:4499903-4499925 GGATGTGGTGGAGCTCAGGTGGG + Intronic
1050460331 9:5872157-5872179 GAACCTGGTAGAGCTCCAGAAGG - Intergenic
1060958848 9:127664660-127664682 TGACCTGTGGGAGCTCAGGCTGG + Intronic
1061163306 9:128908502-128908524 GGAGCTGGAGGTCCTCAAGCTGG + Exonic
1061971411 9:134047414-134047436 AGACCCGGTGGAGCTCACCCTGG + Intronic
1185713980 X:2326594-2326616 GAACCTGGTGGAGCTCCCGGAGG - Intronic
1186976817 X:14916467-14916489 AGACCTGGTGTTGCTCAAGGAGG + Intronic
1187277484 X:17828633-17828655 GGACCTTGATGAGCCCAAGCTGG + Intronic
1192174388 X:68876790-68876812 GGGCCTTGTGGAGCTACAGCAGG - Intergenic
1193251182 X:79292126-79292148 GAACCTGTTGTAGCTAAAGCAGG - Intergenic
1193468636 X:81874671-81874693 GGACCAGGTGCACCACAAGCAGG + Intergenic
1200003426 X:153073254-153073276 GGCCCTGGTCGAGCTCGACCGGG + Exonic
1200004297 X:153076755-153076777 GGCCCTGGTCGAGCTCGACCGGG - Intergenic
1200256118 X:154584394-154584416 GGACCTGCTGGACCTGAGGCTGG - Intergenic
1200261651 X:154620009-154620031 GGACCTGCTGGACCTGAGGCTGG + Intergenic
1200267633 X:154654306-154654328 GGACCTGCTGGACCTGAGGCTGG + Intergenic
1201800736 Y:17952397-17952419 GGACATGGTGGTGCACAAGATGG + Intergenic
1202360515 Y:24104914-24104936 GGACATGGTGGTGCACAAGATGG + Intergenic
1202510263 Y:25565204-25565226 GGACATGGTGGTGCACAAGATGG - Intergenic