ID: 1017831531

View in Genome Browser
Species Human (GRCh38)
Location 6:158134719-158134741
Sequence CCTGAATAACAGTTATTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1017831531_1017831533 17 Left 1017831531 6:158134719-158134741 CCTAACAATAACTGTTATTCAGG 0: 1
1: 0
2: 1
3: 18
4: 206
Right 1017831533 6:158134759-158134781 TTATTATTAAATAAAACCACTGG 0: 1
1: 0
2: 5
3: 43
4: 621

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1017831531 Original CRISPR CCTGAATAACAGTTATTGTT AGG (reversed) Intronic
902160013 1:14522447-14522469 CCTTGATAACTGTAATTGTTAGG - Intergenic
905498183 1:38413051-38413073 CCAGAATAATGGTTATTTTTAGG + Intergenic
905604406 1:39284802-39284824 CCAGAATAAAAGTTATTGAGGGG + Intronic
905904756 1:41610586-41610608 CCTGAATATCAGTCACTGGTGGG + Intronic
908181320 1:61609207-61609229 CCTGCATAACAGATATGCTTTGG - Intergenic
909058629 1:70852690-70852712 TCTGGATAACAGTTATATTTGGG + Intronic
909338072 1:74499429-74499451 CTTTAATAAAAGTTATTGTGGGG - Intronic
909726385 1:78840936-78840958 CCTGACTGACAGTTCTGGTTTGG + Intergenic
911488008 1:98526480-98526502 ACAGAATAACAGTGATTTTTAGG - Intergenic
911974189 1:104471000-104471022 CTTTACTAACAGTTATTGATGGG - Intergenic
912156653 1:106929489-106929511 CCTGAATTAGAGTAATTGTTTGG - Intergenic
912442335 1:109708904-109708926 ACAGAATAACAGTGATTTTTAGG + Intronic
913493650 1:119406240-119406262 CAGGAATGACAGTTATTCTTAGG - Intergenic
918848079 1:189644684-189644706 ACAGAATAACAGTGATTTTTAGG - Intergenic
919069910 1:192741168-192741190 ACTGAACAATAGTTCTTGTTTGG + Intergenic
919125450 1:193387353-193387375 CTTGAATACCTGTTATTTTTTGG + Intergenic
920145161 1:203854225-203854247 CCCGAATTTCAGTTATTATTTGG + Intergenic
920822727 1:209396418-209396440 CCTGAATATCAGTTACAATTAGG + Intergenic
923487005 1:234442986-234443008 CCAGAATAAAAATTATGGTTTGG + Intronic
923621215 1:235581077-235581099 CCTGAGTAACTGATATGGTTTGG + Intronic
924728870 1:246694154-246694176 ACAGAATAACAGTGATTTTTAGG + Intergenic
1063329148 10:5138459-5138481 ACAGAATAACAGTGATTTTTAGG - Intergenic
1064041422 10:11968495-11968517 CCTGAATACCAGTTTTGCTTAGG - Intronic
1064435525 10:15307760-15307782 CCTAAATAAGACTTATTGGTTGG - Intronic
1065253531 10:23841355-23841377 CCTGAGTAACTGTCATTGCTGGG + Intronic
1066151454 10:32624030-32624052 ACTGAATAACTGATATGGTTTGG - Intronic
1066813264 10:39369412-39369434 GCTGGATTACAGTTATTGATTGG + Intergenic
1068417950 10:56749528-56749550 TCTTAATAATAGTTACTGTTAGG - Intergenic
1068568118 10:58597867-58597889 ACAGAATAACAGCGATTGTTAGG - Intronic
1068686705 10:59877797-59877819 CCTGATGAACAATTATTGGTTGG - Intronic
1070217006 10:74395721-74395743 CCTAAAGAACAGTTATGGTTGGG + Intronic
1070438640 10:76419436-76419458 GCTGAATAACATTCATTGTCTGG + Intronic
1070463372 10:76691915-76691937 ACAGAATAACAGTGATTTTTAGG - Intergenic
1072911702 10:99507845-99507867 CTAAAATAACAGTAATTGTTAGG - Intergenic
1078291339 11:10013185-10013207 TCTGAATTACAGTCATAGTTGGG - Intronic
1078641166 11:13098157-13098179 CTTGAATCACAGTCATTGTCTGG + Intergenic
1078670685 11:13362297-13362319 CCTGAATATGAATTATTGTTAGG + Intronic
1080835792 11:35939721-35939743 TCTGACAAACAGTTATTGTCTGG - Intergenic
1080960721 11:37156417-37156439 CCTGAAGAACAGTTATTTATAGG + Intergenic
1084223377 11:67698832-67698854 ACAGAATAACAGTGATTTTTAGG + Intergenic
1085739117 11:79064258-79064280 CCCAAATGACAGTTTTTGTTTGG + Intronic
1086079080 11:82884154-82884176 GCTGAATCACAGCCATTGTTTGG + Intronic
1087905900 11:103697092-103697114 GCTGAATAACATTCTTTGTTTGG + Intergenic
1087959413 11:104329298-104329320 TCTGAATATCAGTCAGTGTTAGG + Intergenic
1088272526 11:108049279-108049301 GCTGAATAATATCTATTGTTTGG + Intronic
1088525841 11:110753443-110753465 CAGGAATACCAGTTATTATTAGG + Intergenic
1090450908 11:126805614-126805636 CCTGAAGAACATTTATTTTCAGG + Intronic
1093709189 12:22310207-22310229 TCAGAATAACAATTATTGATGGG - Intronic
1097627982 12:62024139-62024161 CCTGAATACCAGATTTTGTTGGG - Intronic
1098342641 12:69468585-69468607 CCTGAATCACAGATATTATCAGG - Intergenic
1098533942 12:71573975-71573997 CCTGAATAAGGGTTAGGGTTAGG - Intronic
1098597098 12:72286484-72286506 CCTGAAAAACTTTTATGGTTGGG + Intronic
1099098482 12:78405617-78405639 CCTGAATAAGATTGATTCTTAGG + Intergenic
1101034645 12:100693415-100693437 CATGAATAACAGATATTCTTAGG - Intergenic
1103175457 12:118859504-118859526 GCTTAATAAGAGTTATTGATTGG - Intergenic
1105897796 13:24731962-24731984 ACAGAATAACAGTGATTTTTAGG - Intergenic
1106529149 13:30572002-30572024 CCTGAATAGCAGATATTACTTGG + Intronic
1106645341 13:31628557-31628579 ACAGAATAACAGTGATTTTTAGG - Intergenic
1108375475 13:49810085-49810107 GCTGAATAACTTTTATTATTAGG - Intergenic
1109667257 13:65555695-65555717 CCTGAAAAACACTTATTAATTGG - Intergenic
1110660769 13:78057337-78057359 ACAGAATAACAGTGATTTTTAGG - Intergenic
1112925406 13:104668090-104668112 CTTCAATTACAGTTGTTGTTTGG + Intergenic
1113214017 13:108017264-108017286 GCAGAATAACAGTGATTTTTAGG + Intergenic
1113536638 13:111071881-111071903 ACAGAATAACAGTGATTTTTAGG - Intergenic
1116075275 14:40102862-40102884 TCTGAATAAAAGTTAGTGCTTGG + Intergenic
1120032108 14:79653736-79653758 CCTGATTCACAATTATTATTTGG - Intronic
1120258572 14:82153097-82153119 CCTGAATTATAGTTACAGTTTGG - Intergenic
1125005091 15:34807788-34807810 ACAGAATAACAGTGATTTTTAGG - Intergenic
1125641513 15:41234602-41234624 AATGAATAACAGTAAGTGTTTGG + Intronic
1126521187 15:49595986-49596008 CAGGAATACCAGTTATTTTTAGG - Intronic
1129691250 15:77714821-77714843 TCTGGGTATCAGTTATTGTTTGG - Intronic
1130451692 15:84060592-84060614 ACTGAATAACTTTTATTTTTTGG + Intergenic
1132082170 15:98875701-98875723 CCTGAAAATCAGCTAATGTTTGG + Intronic
1137942377 16:52701150-52701172 CCTGCATCGCAGTTACTGTTTGG - Intergenic
1140166815 16:72561168-72561190 CCTTACTAACAGTTATTTATGGG - Intergenic
1153474425 18:5482383-5482405 CCTGAATACCAATAATTCTTAGG - Intronic
1155214077 18:23627305-23627327 CCTGAATAACAATTCTTTTAGGG + Intronic
1155322903 18:24636395-24636417 TCTGAATAACACTTATTGGTTGG + Intergenic
1156690403 18:39700538-39700560 CCTGAATATCAGGTATTGTCTGG - Intergenic
1157206579 18:45705618-45705640 ACTTAATAATAGTTATTGTGGGG - Intergenic
1157961082 18:52154107-52154129 GCTTAATAACTGTTATTGATTGG - Intergenic
1158772341 18:60534524-60534546 CCTGTATAACAATAATTGTAGGG + Intergenic
1158815521 18:61090455-61090477 ACTAAATAACATTGATTGTTTGG + Intergenic
1160620223 18:80165408-80165430 ACAGAATAACAGTGATTTTTAGG - Intronic
1167980558 19:53271671-53271693 CCTGAATAACATTTGTTTGTAGG - Intergenic
926041965 2:9680658-9680680 CCTGATTAACACTTATTCTTAGG + Intergenic
926402145 2:12508358-12508380 CTTGAATAATAGTGACTGTTAGG + Intergenic
930493140 2:52102124-52102146 CCAGAATAGCTGATATTGTTTGG - Intergenic
931856372 2:66305967-66305989 TATGAATAACAGTAATTGTTTGG + Intergenic
933514684 2:83285592-83285614 CCATAAGAACAGCTATTGTTTGG + Intergenic
937631975 2:124111784-124111806 CAGGAATAAAAGTTATTATTTGG - Intronic
938640040 2:133268015-133268037 CTTGAATGACAGTATTTGTTTGG + Intronic
939617837 2:144380334-144380356 CCTGGAAAACAGAAATTGTTTGG - Intergenic
940520400 2:154738329-154738351 ACTGAATAACACTTATTGTTTGG + Intronic
941549022 2:166890712-166890734 CCTAAATAACAGGTATTGTCTGG + Intronic
942355892 2:175109506-175109528 CCTGAATAACTGTTTCTTTTAGG - Intronic
942538523 2:176991087-176991109 ATTGAATAAAAATTATTGTTGGG + Intergenic
942718299 2:178919839-178919861 AATGAATAGCTGTTATTGTTCGG + Intronic
942737184 2:179127752-179127774 CTTGTTTATCAGTTATTGTTTGG + Intronic
943273275 2:185835803-185835825 ACTAAATAACAGTGATTTTTAGG + Intergenic
943391587 2:187276240-187276262 GATGAATAACATTTATTGATTGG + Intergenic
944404545 2:199368267-199368289 ACTGATTAACAGATACTGTTGGG - Intronic
945233524 2:207613339-207613361 CCTTAACAACAGTTTTAGTTTGG + Exonic
945625757 2:212203780-212203802 CCTGAATGACAGGTAAAGTTGGG - Intronic
945820039 2:214652534-214652556 CCTGACTCACAATTATTCTTTGG + Intergenic
1169040578 20:2491746-2491768 CTGTAAAAACAGTTATTGTTTGG + Intronic
1172448981 20:35008540-35008562 CCTGAAGCACAATTACTGTTGGG - Intronic
1174883455 20:54305864-54305886 TCTGAAATACAATTATTGTTAGG - Intergenic
1180990840 22:19935036-19935058 ACAGAATAACAGTGATTTTTAGG + Intronic
1181522593 22:23458241-23458263 CCTGGAGAACAGCTATTCTTTGG + Intergenic
1184751526 22:46489091-46489113 GCTGAATTGCAGTTATTCTTTGG - Intronic
949297248 3:2539815-2539837 CCTGAATATCAGTTATCATAAGG - Intronic
949598582 3:5574479-5574501 CCTCAATAAAAGTGTTTGTTTGG + Intergenic
951051455 3:18098692-18098714 CCAGTATAACAGAAATTGTTGGG + Intronic
951240653 3:20282754-20282776 ACAGAATAACAGTGATTTTTAGG + Intergenic
955716915 3:61839262-61839284 CCTGAAAAATATTTACTGTTCGG + Intronic
957290622 3:78273304-78273326 CCTGAATCACATTTAATCTTGGG - Intergenic
960011879 3:112842503-112842525 ACAGAATAACAGTAATTTTTAGG + Intronic
962052972 3:131837739-131837761 CCTAAATGACAGATATTATTTGG - Intronic
964799597 3:160540588-160540610 CCCGAAGAACAACTATTGTTTGG - Intronic
968041127 3:195590213-195590235 ACAGAATAACAGTGATTTTTAGG - Intergenic
969873519 4:10119127-10119149 CCTGATTAACAGTTGTGGGTGGG - Intergenic
970448578 4:16144929-16144951 ACAGAATAACAGTGATTTTTAGG + Intergenic
973799869 4:54466929-54466951 ACAGAATAACAGTGATTTTTAGG + Intergenic
974185542 4:58440840-58440862 ACAGAATAACAGTGATTTTTAGG - Intergenic
974645558 4:64687045-64687067 ACAGAATAACAGTGATTTTTAGG + Intergenic
975228620 4:71905272-71905294 ACAGAATAACAGTGATTTTTAGG + Intergenic
975363858 4:73504955-73504977 TCTGAATAACAGATTTTGTAAGG - Intergenic
975897875 4:79116990-79117012 ACAGAATAACAGTGATTTTTAGG + Intergenic
976645587 4:87384379-87384401 ACAGAATAACAGTGATTTTTAGG + Intronic
976914625 4:90356461-90356483 CTTGAATAACAACTAGTGTTTGG + Intronic
976962976 4:91002376-91002398 CAGGAATACCAGTTATTCTTAGG + Intronic
977354304 4:95926199-95926221 ACAGAATAACAGTGATTTTTAGG + Intergenic
977489378 4:97692562-97692584 CGGGAATACCAATTATTGTTAGG - Intronic
979187982 4:117822788-117822810 CCTGAATAAAAGTTAGAATTTGG - Intergenic
980987084 4:139705843-139705865 CCTGAAGTGCAGTTATTGTCTGG + Intronic
981226982 4:142308367-142308389 CCTGATATACAGTTATTTTTAGG - Intronic
982346059 4:154361165-154361187 CCTGAATAAAAGAGATAGTTTGG + Intronic
983505999 4:168554196-168554218 CCTGAAAAACCATTATTATTAGG + Intronic
987591451 5:19933038-19933060 CCTGCATTACAGTTATGATTAGG - Intronic
987707507 5:21474624-21474646 CATGTTTAAGAGTTATTGTTAGG - Intergenic
987742797 5:21931567-21931589 CCTGAAAGTCAGTTATTCTTGGG - Intronic
988262610 5:28908090-28908112 CCTGAATAACACATAAGGTTGGG - Intergenic
988714606 5:33812536-33812558 TCAGAATAACAGTTATCTTTGGG - Intronic
989131579 5:38112308-38112330 ACTGAATAACATTCATTGTATGG + Intergenic
989518631 5:42374641-42374663 CTTGAATAACGGGCATTGTTTGG + Intergenic
990787184 5:59434779-59434801 CCTGATTAGCAGTTATTGTCTGG - Intronic
993807098 5:92424545-92424567 CATGGATAACAGATATGGTTTGG - Intergenic
994875847 5:105419745-105419767 ACAGAATAACAGTGATTTTTAGG - Intergenic
995991577 5:118246350-118246372 CCTGAAGTACAGTTATTAATTGG + Intergenic
996542836 5:124648052-124648074 CCTGAACAACAGTTGTTGTGAGG + Exonic
997761064 5:136447589-136447611 CAGGAATACCAGTTATTCTTAGG - Intergenic
998608772 5:143665118-143665140 CCTGGGTAACAGTGATTGGTGGG - Intergenic
998880940 5:146644118-146644140 CATGAATACAAGTTATTTTTTGG - Intronic
999942537 5:156559698-156559720 CCTCAGTAACAGTGGTTGTTAGG + Intronic
1001308707 5:170595132-170595154 CCTGAATGACAGGTATTCATTGG + Intronic
1004672087 6:17807164-17807186 ACAGAATAACAGTGATTTTTAGG + Intronic
1009267226 6:61570434-61570456 CAGGAACAACAGTTATTCTTAGG - Intergenic
1009479841 6:64142971-64142993 ACTGAATAATATTCATTGTTTGG - Intronic
1009929423 6:70159321-70159343 CCTGCATACAAGTTAATGTTAGG + Intronic
1010776440 6:79891464-79891486 CTGGAATAACAGCTATTTTTAGG - Intergenic
1010803939 6:80212493-80212515 ACAGAATAACAGTGATTTTTAGG - Intronic
1011373423 6:86665186-86665208 CCAGAATACCAATTATTCTTAGG + Intergenic
1015378133 6:132534230-132534252 ACAGAATAACAGTGATTTTTAGG + Intergenic
1015899993 6:138054485-138054507 CATGAACACCAGTTATTCTTAGG - Intergenic
1017831531 6:158134719-158134741 CCTGAATAACAGTTATTGTTAGG - Intronic
1018770214 6:166963775-166963797 GCTCAATATCAGTGATTGTTAGG - Intergenic
1023530735 7:41150724-41150746 CCTGAATACCAAATATTGCTTGG + Intergenic
1023603898 7:41909654-41909676 GCAGAATAACAGTGATTTTTAGG - Intergenic
1024103262 7:46055662-46055684 CCTTAATAACACTTACTTTTGGG - Intergenic
1024952887 7:54883106-54883128 ATTGCATAACAGATATTGTTTGG - Intergenic
1025743797 7:64225278-64225300 ACAGAATAACAGTGATTTTTAGG - Intronic
1025755345 7:64332911-64332933 ACAGAATAACAGTGATTTTTAGG - Intronic
1027548951 7:79567109-79567131 CCTGAAGAACAGTTAGGGGTTGG - Intergenic
1028149972 7:87360701-87360723 CCTTAATAACTGTTATTATTAGG + Intronic
1028703978 7:93816340-93816362 CTTGAATTACAGTTATACTTGGG - Intronic
1030877315 7:114831217-114831239 CCTGCAAAACTGTTCTTGTTGGG + Intergenic
1031090300 7:117346873-117346895 CAGGAATACCAGTTATTCTTAGG + Intergenic
1033886931 7:145960724-145960746 ACTGAATAACATTTAGTTTTAGG - Intergenic
1034251733 7:149697695-149697717 ACAGAATAACAGTGATTTTTAGG + Intergenic
1034300749 7:150013445-150013467 CCTGAATCACAGGTATTGAGAGG - Intergenic
1034805301 7:154083855-154083877 CCTGAATCACAGGTATTGAGAGG + Intronic
1037012768 8:13864944-13864966 AGTGAATAACATTTATTTTTTGG + Intergenic
1037312640 8:17573112-17573134 ACAGAATAACAGTGATTTTTAGG + Intergenic
1037341155 8:17846881-17846903 CCTGTATAACATTTACTGTACGG - Intergenic
1038204635 8:25454215-25454237 CCTGAAGAAAAGTTATTTCTTGG + Intronic
1039669280 8:39578680-39578702 ACAGAATAACAGTGATTTTTAGG + Intergenic
1040088910 8:43375271-43375293 CATGAACAAAAATTATTGTTTGG - Intergenic
1042813920 8:72857146-72857168 CCTGAAAGACAGTGATTGTATGG - Intronic
1042979815 8:74513734-74513756 CCTGAATCACAGTGATAGCTGGG - Intergenic
1044002089 8:86895309-86895331 GCTGAATAATATTTATTGTATGG + Intronic
1046061462 8:109144726-109144748 CCAGGATAACTGTTATGGTTTGG + Intergenic
1046187299 8:110738395-110738417 TCTGAAGAACAGTTTTTGCTGGG + Intergenic
1046749741 8:117914412-117914434 ACAGAATAACAGTGATTTTTAGG + Intronic
1046995683 8:120519532-120519554 CCTGAATCACAGTTATCTGTGGG + Intronic
1047661902 8:127046604-127046626 ACAGAATAACAGTGATTTTTAGG + Intergenic
1050055848 9:1653300-1653322 CTTGAACAGCATTTATTGTTTGG + Intergenic
1050834313 9:10056655-10056677 ACTGAATCACAGTTACTCTTGGG - Intronic
1052831813 9:33221777-33221799 GCTGAATCACAGTCCTTGTTAGG + Intronic
1057029551 9:91764748-91764770 CCTGAATAACATTCATTCTTTGG + Intronic
1057409039 9:94800166-94800188 CCTTAATAACAGCTTTTGATGGG + Intronic
1058041877 9:100311399-100311421 CTTGAATAACACTTATTTTTTGG - Intronic
1059199357 9:112399809-112399831 ACAGAATAACAGTGATTTTTAGG - Intronic
1059727719 9:117025724-117025746 CCTGGATAAAAGTTATTAGTAGG - Intronic
1059979465 9:119754265-119754287 CCTCAATAACACTTATTATTTGG + Intergenic
1060975734 9:127764015-127764037 CCTGAATAGCAGGAAATGTTGGG - Intronic
1185558348 X:1039055-1039077 CCTGAATAATGGTTAGTGTAAGG - Intergenic
1189301428 X:39955307-39955329 CCTGTATCACAGTTATTAATGGG - Intergenic
1189879014 X:45470128-45470150 CCAGAACACCAGTTATTCTTAGG + Intergenic
1190373070 X:49761808-49761830 TCTGAATAACTTTTATAGTTTGG - Intergenic
1191091840 X:56631864-56631886 GCTGAATTACATTTATTGATTGG + Intergenic
1192859447 X:75050687-75050709 CTTGAAAAGCAGTTATTGTAGGG - Intergenic
1193154733 X:78159923-78159945 CATGAATACCAATTATTCTTAGG - Intergenic
1193538467 X:82741615-82741637 GATAAATAACATTTATTGTTTGG + Intergenic
1193809058 X:86030063-86030085 CCTAAGTAAGAGTTATTTTTGGG - Intronic
1193864482 X:86713908-86713930 ACTTAATAACAAATATTGTTAGG - Intronic
1195023529 X:100852919-100852941 CCTGAATCCCAGTTAATGCTGGG - Intronic
1195174165 X:102298534-102298556 CCTGAAAAACAATGACTGTTAGG - Intergenic
1195184700 X:102388558-102388580 CCTGAAAAACAATGACTGTTAGG + Intronic
1195857116 X:109343471-109343493 GCTTAGTAACAGTTATTCTTAGG - Intergenic
1196899626 X:120369952-120369974 ACTGAATTTCAGATATTGTTAGG + Intronic
1197101501 X:122661399-122661421 TCTGAAAAACAGTTCTTGTTTGG + Intergenic
1197270716 X:124422271-124422293 CCTGAAAAACAGTCACAGTTTGG + Exonic
1197462444 X:126758922-126758944 TCTGAGTTACAGTTATTTTTTGG - Intergenic
1198061368 X:133048257-133048279 TATAATTAACAGTTATTGTTTGG - Intronic
1201434884 Y:13946489-13946511 TGTGAATAAAAGTTATTTTTAGG - Intergenic